Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > A259 > Y19870 > A5902

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B59960
BigY2
B59960
FGC
KA2ZZ
20776675-A-G 18614789-A-G P4_Prx ***A*
13449858-A-G 11294182-A-G A*
6334539-T-A 6466498-T-A IR3_Dst ***A*
22179331-A-G 20017445-A-G FGC67686 YY+++
18551133-A-AT 16439253-A-AT 9×T++**
15992284-A-G 13880404-A-G FGC67685 YY+++
13848848-C-T 11728142-C-T FGC67683 +++
22460726-G-C 20298840-G-C FGC67687 DYZ19 ++*
8697192-G-A 8829151-G-A FGC67682 YY+++
15963498-G-T 13851618-G-T FGC67684 Y***
7289475-C-T 7421434-C-T FGC67681 YY***
14515310-AAGATAGATAGAT-A 12403515-AAGATAGAT-A 13×AGAT***
5965450-G-A 6097409-G-A **
6358396-G-T 6490355-G-T **
5817951-C-G 5949910-C-G **
5849310-C-A 5981269-C-A **
5859168-C-A 5991127-C-A **
5867265-C-A 5999224-C-A **
6358402-A-C 6490361-A-C **
6357975-C-G 6489934-C-G **
5981232-A-C 6113191-A-C **
6310790-A-AT 6442749-A-AT IR3_Dst **
6310783-T-C 6442742-T-C IR3_Dst **
6310766-C-T 6442725-C-T IR3_Dst **
6267665-T-C 6399624-T-C IR3_Dst **
5867350-TC-T 5999309-TC-T **
6028140-T-G 6160099-T-G **
5996982-A-C 6128941-A-C **
13915098-T-C 11794392-T-C *****
6366431-G-A 6498390-G-A **
5817905-A-C 5949864-A-C **
6582804-A-T 6714763-A-T **
6790235-A-G 6922194-A-G **
6786701-C-A 6918660-C-A Y60964 **
6699019-TA-C 6830978-TA-C **
6654991-T-A 6786950-T-A **
6608329-C-T 6740288-C-T **
6608316-A-C 6740275-A-C **
6608234-T-G 6740193-T-G **
6580116-T-G 6712075-T-G **
6366486-A-C 6498445-A-C **
6576534-T-C 6708493-T-C **
6492022-G-A 6623981-G-A **
6470776-G-A 6602735-G-A **
6454744-C-A 6586703-C-A **
6414311-A-T 6546270-A-T **
6405212-T-C 6537171-T-C **
6392536-T-A 6524495-T-A **
5817928-A-G 5949887-A-G **
5663436-C-A 5795395-C-A **
5792966-A-T 5924925-A-T **
5187024-A-C 5318983-A-C **
5238663-A-C 5370622-A-C **
5238455-A-G 5370414-A-G **
5238387-A-T 5370346-A-T **
5221041-G-T 5353000-G-T **
5221029-C-T 5352988-C-T **
5205369-C-A 5337328-C-A **
5200168-C-A 5332127-C-A **
5187002-T-A 5318961-T-A **
5367154-C-A 5499113-C-A **
5186971-T-C 5318930-T-C **
5186969-G-A 5318928-G-A **
5186966-T-A 5318925-T-A **
5169863-T-A 5301822-T-A **
5069761-G-T 5201720-G-T **
5056547-G-T 5188506-G-T **
5035826-G-T 5167785-G-T **
5367069-G-A 5499028-G-A **
5376434-A-C 5508393-A-C **
5787339-A-T 5919298-A-T **
5593083-A-G 5725042-A-G **
5753141-T-A 5885100-T-A **
5728237-C-A 5860196-C-A **
5698641-T-G 5830600-T-G **
6830088-G-A 6962047-G-A **
5645972-G-A 5777931-G-A **
5606149-A-G 5738108-A-G **
5603753-A-T 5735712-A-T **
5587263-C-A 5719222-C-A **
5420481-T-C 5552440-T-C **
5585102-C-A 5717061-C-A **
5534746-T-C 5666705-T-C **
5524330-T-G 5656289-T-G **
5471943-AG-A 5603902-AG-A **
5471929-AAAGAAAGAAAG-A 5603888-AAAGAAAGAAAG-A **
5471793-C-A 5603752-C-A **
5420588-T-G 5552547-T-G **
6798818-C-A 6930777-C-A **
6992631-C-A 7124590-C-A **
6918525-G-C 7050484-G-C **
9887915-T-A 10050306-T-A **
10656093-A-G **
10656063-C-A **
10653669-C-A **
10651652-A-AC **
10625708-C-A **
10057020-A-C 10219411-A-C **
9942344-A-T 10104735-A-T **
9928315-T-C 10090706-T-C **
9832626-C-T 9995017-C-T **
10656170-T-G **
9773689-C-A 9936080-C-A **
9639052-G-T 9801443-G-T IR3_Prx **
9566728-A-G 9729119-A-G IR3_Prx **
9514413-G-C 9676804-G-C **
9509716-C-A 9672107-C-A **
9472275-C-A 9634666-C-A **
9436953-C-A 9599344-C-A **
9211372-C-T 9373763-C-T **
10656094-C-G **
10657163-T-C **
8983721-G-C 9146112-G-C **
10756221-C-T **
10801220-A-T **
10796539-T-C **
10771069-C-A **
10768376-C-A **
10768318-C-T **
10762411-A-C **
10761828-T-C **
10761824-C-G **
10756163-A-T **
10668269-C-A **
10756056-G-A **
10756044-C-A **
10755980-T-A **
10749032-A-G **
10693523-T-G **
10687153-A-C **
10686177-C-A **
10678451-C-A **
9211362-C-G 9373753-C-G **
9113745-A-C **
6984027-C-A 7115986-C-A **
7313412-G-A 7445371-G-A **
7475306-C-T 7607265-C-T IR1_L **
7475298-C-A 7607257-C-A IR1_L **
7450256-G-T 7582215-G-T IR1_L **
7362491-A-G 7494450-A-G **
7362437-A-G 7494396-A-G **
7362425-C-A 7494384-C-A **
7320261-C-G 7452220-C-G **
7313468-T-G 7445427-T-G **
7312627-A-T 7444586-A-T **
7590737-A-C 7722696-A-C **
7235869-G-A 7367828-G-A **
7183803-A-C 7315762-A-C **
7169853-A-T 7301812-A-T **
7160946-T-A 7292905-T-A **
7132018-A-G 7263977-A-G **
7127399-T-C 7259358-T-C **
7048593-A-T 7180552-A-T **
5025531-T-G 5157490-T-G **
7579623-A-G 7711582-A-G **
7629954-C-T 7761913-C-T **
8824079-C-A 8956038-C-A **
8154168-G-T 8286127-G-T **
8739220-A-G 8871179-A-G **
8739131-C-G 8871090-C-G **
8661314-C-T 8793273-C-T **
8525177-T-A 8657136-T-A **
8481103-AT-A 8613062-AT-A **
8481077-TA-T 8613036-TA-T **
8481074-A-AT 8613033-A-AT **
8314144-A-G 8446103-A-G **
7969529-C-T 8101488-C-T **
7645408-T-A 7777367-T-A **
7969189-T-A 8101148-T-A **
7923772-A-C 8055731-A-C **
7923738-T-C 8055697-T-C **
7873950-A-T 8005909-A-T **
7869121-A-T 8001080-A-T **
7861243-A-T 7993202-A-T **
7829040-G-T 7960999-G-T **
7656740-T-G 7788699-T-G **
5025579-G-C 5157538-G-C **
5025473-C-A 5157432-C-A **
10801940-C-A **
21328846-A-T 19166960-A-T **
10992260-C-G **
4678975-CA-C 4810934-CA-C 14×A**
10812492-C-A **
28730088-C-A 26583941-C-A **
6816748-A-C 6948707-A-C **
10889215-A-T **
14639045-A-G 12527114-A-G **
14934299-G-T 12822364-G-T **
13642633-C-A 11486957-C-A **
28633565-C-A 26487418-C-A **
15128121-C-CTT 13016208-C-CTT 18×T**
11029376-G-C **
16941633-C-A 14829753-C-A **
7269652-C-T 7401611-C-T **
10969488-C-T **
4871743-C-A 5003702-C-A **
19592223-C-A 17480343-C-A P5_Prx **
8481967-TAAA-T 8613926-TAAA-T 15×A**
2948150-C-A 3080109-C-A **
10746890-T-A **
15406937-C-T 13295057-C-T **
28611430-GA-G 26465283-GA-G 13×A**
11018268-C-A **
3298985-G-GA 3430944-G-GA 11×A**
4416892-T-G 4548851-T-G **
28611452-C-A 26465305-C-A **
23848280-G-T 21686394-G-T **
5727899-C-A 5859858-C-A **
4230247-C-A 4362206-C-A **
16421585-C-A 14309705-C-A **
4521605-T-C 4653564-T-C **
18890451-TCAA-T 16778571-TCAA-T 5×CAA**
10804749-T-A **
15406933-C-A 13295053-C-A **
21133482-G-C 18971596-G-C **
10965096-C-CCACCA **
10980574-G-A **
23099854-C-A 20937968-C-A **
7645202-ATTTTT-A 7777161-ATTTTT-A 17×T**
56858501-G-A **
3536395-G-T 3668354-G-T **
19304703-C-A 17192823-C-A **
9183743-C-A 9346134-C-A **
20423060-G-T 18261174-G-T P5_Dst **
17876450-T-G 15764570-T-G **
19130771-TG-T 17018891-TG-T **
10756069-C-T **
27861908-C-A 25715761-C-A P1_Y2 **
14764903-A-T 12652972-A-T **
6267716-G-A 6399675-G-A IR3_Dst **
20637578-G-GATAGAT 18475692-G-GATAGAT P4_Prx 25×AT**
20242504-G-T 18080618-G-T P5_Dst **
15128152-C-A 13016239-C-A **
9968320-G-A 10130711-G-A **
10992345-C-T **
11030770-T-C **
11030765-T-G **
9211368-C-G 9373759-C-G **
10898292-G-C **
3550675-C-A 3682634-C-A **
10535-C-A **
6765639-G-C 6897598-G-C **
15882060-G-A 13770180-G-A **
15557051-AG-A 13445171-AG-A **
20637669-C-T 18475783-C-T P4_Prx **
17128535-CTTTT-C 15016655-CTTTT-C 25×T**
7269641-A-G 7401600-A-G **
6770773-G-T 6902732-G-T **
6267674-T-C 6399633-T-C IR3_Dst **
10865853-C-A **
13846728-T-A 11726022-T-A **
4081612-A-G 4213571-A-G **
4416886-T-G 4548845-T-G **
16545412-AC-A 14433532-AC-A **
6150064-C-T 6282023-C-T IR3_Dst **
11018168-C-A **
10959465-ACTGCT-A **
4521611-C-A 4653570-C-A **
24013901-C-T 21867754-C-T **
17030605-G-TT 14918725-G-TT **
10965084-T-C **
3804725-T-C 3936684-T-C **
13255798-A-C 11100122-A-C **
10862989-C-T **
10677727-A-C **
13578392-C-A 11422716-C-A **
4968902-T-G 5100861-T-G **
4062268-C-A 4194227-C-A **
4124113-A-G 4256072-A-G **
4120594-C-CA 4252553-C-CA **
4114877-G-C 4246836-G-C **
4109524-G-T 4241483-G-T **
4091814-C-T 4223773-C-T **
4081706-C-A 4213665-C-A **
4072679-T-A 4204638-T-A **
4063237-G-T 4195196-G-T **
3966802-A-G 4098761-A-G **
4225939-A-G 4357898-A-G **
3875977-C-T 4007936-C-T **
3848589-T-A 3980548-T-A **
3848301-C-T 3980260-C-T **
3835091-A-C 3967050-A-C **
3828969-G-C 3960928-G-C **
3820831-C-G 3952790-C-G **
3784682-T-A 3916641-T-A **
3697220-G-T 3829179-G-T **
4133950-T-C 4265909-T-C **
4270719-C-A 4402678-C-A **
3667165-C-G 3799124-C-G **
4679014-G-A 4810973-G-A **
4940720-G-A 5072679-G-A **
4929156-C-A 5061115-C-A **
4902253-C-G 5034212-C-G **
4882645-G-C 5014604-G-C **
4882530-G-A 5014489-G-A **
4862866-T-C 4994825-T-C **
4804245-T-A 4936204-T-A **
4760676-G-T 4892635-G-T **
4638795-C-T 4770754-C-T **
4302979-T-C 4434938-T-C **
4625737-A-T 4757696-A-T **
4523831-A-C 4655790-A-C **
4423637-C-A 4555596-C-A **
4368794-G-T 4500753-G-T **
4357695-T-C 4489654-T-C **
4356900-C-A 4488859-C-A **
4351536-T-G 4483495-T-G **
4302989-T-C 4434948-T-C **
3697095-T-C 3829054-T-C **
3642700-C-A 3774659-C-A **
18201127-G-A 16089247-G-A **
27423950-T-A 25277803-T-A P1_g3 **
2839979-C-A 2971938-C-A **
2775050-A-T 2907009-A-T **
2773899-A-C 2905858-A-C **
2699426-G-C 2831385-G-C **
18480352-A-C 16368472-A-C P6_Dst **
23825090-GA-G 21663204-GA-G **
18201146-A-G 16089266-A-G **
3550574-CAAAA-C 3682533-CAAAA-C 24×A**
11034083-C-T **
2948800-A-T 3080759-A-T **
10814590-C-A **
25246609-A-T 23100462-A-T P2_r1 **
10889876-A-G **
10889190-A-C **
15179003-T-A 13067089-T-A **
18966217-C-A 16854337-C-A **
10889187-A-C **
24013904-C-A 21867757-C-A **
2860491-G-T 2992450-G-T **
2948819-T-A 3080778-T-A **
3555737-C-A 3687696-C-A **
3366272-G-C 3498231-G-C **
3550815-G-T 3682774-G-T **
3550774-G-T 3682733-G-T **
3534923-A-C 3666882-A-C **
3492838-G-T 3624797-G-T **
3492781-A-T 3624740-A-T **
3463881-T-G 3595840-T-G **
3463879-T-G 3595838-T-G **
3368353-A-T 3500312-A-T **
3287247-C-A 3419206-C-A **
2973059-G-T 3105018-G-T **
3285170-G-T 3417129-G-T **
3271681-G-T 3403640-G-T **
3271675-C-T 3403634-C-T **
3267347-G-A 3399306-G-A **
3241744-C-A 3373703-C-A **
3109320-A-G 3241279-A-G **
3093191-T-A 3225150-T-A **
3091735-C-A 3223694-C-A **
3032476-T-C 3164435-T-C **
10801818-A-T **
10820117-C-A **
10806935-C-T **
19107445-TA-T 16995565-TA-T **
19518723-T-G 17406843-T-G **
19486905-T-C 17375025-T-C **
19464528-T-G 17352648-T-G **
19245678-C-T 17133798-C-T **
19146601-G-C 17034721-G-C **
19137582-C-T 17025702-C-T **
19127687-CA-C 17015807-CA-C **
18791529-A-T 16679649-A-T **
19592203-T-G 17480323-T-G P5_Prx **
18791431-T-C 16679551-T-C **
18791340-T-A 16679460-T-A **
18753060-G-C 16641180-G-C **
18753052-A-C 16641172-A-C **
18753011-C-T 16641131-C-T **
18624486-A-T 16512606-A-T **
18565059-CTCA-C 16453179-CTCA-C **
18518159-G-T 16406279-G-T P6_Dst **
19532796-C-A 17420916-C-A **
19592242-T-A 17480362-T-A P5_Prx **
18201107-C-A 16089227-C-A **
19948127-C-CAT 17836247-C-CAT P5_Prx **
20854469-T-TG 18692583-T-TG P4_Dst **
20707615-A-G 18545729-A-G P4_Prx **
20637673-T-A 18475787-T-A P4_Prx **
20569557-G-T 18407671-G-T P5_Dst **
20493594-T-A 18331708-T-A P5_Dst **
20493554-A-C 18331668-A-C P5_Dst **
20354926-T-G 18193040-T-G P5_Dst **
19948131-C-CT 17836251-C-CT P5_Prx **
19948117-T-TC 17836237-T-TC P5_Prx **
19592338-T-TA 17480458-T-TA P5_Prx **
19948113-T-C 17836233-T-C P5_Prx **
19948109-T-A 17836229-T-A P5_Prx **
19899626-A-AAGGC 17787746-A-AAGGC P5_Prx **
19899589-G-T 17787709-G-T P5_Prx **
19899581-G-A 17787701-G-A P5_Prx **
19705301-T-TA 17593421-T-TA P5_Prx **
19705244-C-A 17593364-C-A P5_Prx **
19644653-A-G 17532773-A-G P5_Prx **
18465446-A-G 16353566-A-G P6_Dst **
18196394-G-T 16084514-G-T **
21241756-TA-T 19079870-TA-T **
16147498-G-A 14035618-G-A P8_Dst **
16417281-T-C 14305401-T-C **
16410241-C-A 14298361-C-A **
16354921-A-G 14243041-A-G **
16320428-A-T 14208548-A-T **
16320387-T-G 14208507-T-G **
16220903-C-T 14109023-C-T **
16179720-T-C 14067840-T-C **
16147493-AG-A 14035613-AG-A P8_Dst **
16709778-C-A 14597898-C-A **
16090345-G-C 13978465-G-C **
16070666-C-A 13958786-C-A **
16056121-C-A 13944241-C-A **
16017598-G-A 13905718-G-A **
16017564-A-C 13905684-A-C **
16016329-C-A 13904449-C-A **
16006819-C-A 13894939-C-A **
16003023-C-A 13891143-C-A **
16707101-C-A 14595221-C-A **
16709782-T-G 14597902-T-G **
18185022-C-G 16073142-C-G **
17317780-G-A 15205900-G-A **
18094167-A-G 15982287-A-G **
18094042-A-G 15982162-A-G **
17883950-A-C 15772070-A-C **
17576227-T-G 15464347-T-G **
17503974-G-T 15392094-G-T **
17426599-T-C 15314719-T-C **
17402472-TA-T 15290592-TA-T **
17382319-A-T 15270439-A-T **
17246494-T-C 15134614-T-C **
16709783-G-T 14597903-G-T **
17244335-A-G 15132455-A-G **
17153332-T-A 15041452-T-A **
17125910-G-T 15014030-G-T **
17052984-C-A 14941104-C-A **
17020553-T-A 14908673-T-A **
17020552-A-C 14908672-A-C **
16989100-A-C 14877220-A-C **
16941986-C-A 14830106-C-A **
20888629-G-A 18726743-G-A P4_Dst **
21328837-TC-T 19166951-TC-T **
15952699-G-T 13840819-G-T **
26139997-T-G 23993850-T-G P1_Y1 **
27873594-G-T 25727447-G-T P1_Y2 **
27800402-A-AG 25654255-A-AG P1_Y2 **
27633620-G-A 25487473-G-A P1_Y2 **
27552538-C-A 25406391-C-A P1_Y2 **
27423964-C-A 25277817-C-A P1_g3 **
27232159-C-A 25086012-C-A P1_g3 **
26477985-C-A 24331838-C-A P1_Y1 **
26098016-A-AAAAAG 23951869-A-AAAAAG P1_Y1 **
28361372-T-A 26215225-T-A P1_gr2 **
26041918-A-T 23895771-A-T P1_Y1 **
25995443-A-AAT 23849296-A-AAT P1_Y1 **
25934585-T-C 23788438-T-C P1_Y1 **
24751259-A-G 22605112-A-G P3_b2 **
24525867-A-AG 22379720-A-AG P3_t2 **
24512272-A-G 22366125-A-G **
24458769-A-AG 22312622-A-AG **
24406509-A-T 22260362-A-T **
28064066-A-G 25917919-A-G P1_Y2 **
28361445-T-TA 26215298-T-TA P1_gr2 **
24013909-C-T 21867762-C-T **
28660669-T-A 26514522-T-A **
56881340-A-T **
56848355-A-T **
56848333-G-C **
56845900-C-A **
56839066-C-A **
28758167-C-T 26612020-C-T **
28707815-G-T 26561668-G-T **
28706304-G-A 26560157-G-A **
28645099-A-T 26498952-A-T **
28429404-C-G 26283257-C-G P1_gr2 **
28611460-C-A 26465313-C-A **
28611450-A-T 26465303-A-T **
28581112-A-G 26434965-A-G **
28545334-T-G 26399187-T-G **
28521663-C-A 26375516-C-A **
28513798-C-A 26367651-C-A **
28486145-G-A 26339998-G-A **
28480193-A-T 26334046-A-T **
24402388-T-A 22256241-T-A **
24013891-G-A 21867744-G-A **
21353274-G-A 19191388-G-A **
21886329-A-T 19724443-A-T **
22146489-C-T 19984603-C-T **
22080673-G-T 19918787-G-T **
21969526-T-A 19807640-T-A **
21963817-C-T 19801931-C-T **
21954473-C-T 19792587-C-T **
21919340-C-A 19757454-C-A **
21891125-A-C 19729239-A-C **
21852517-T-A 19690631-T-A **
22210513-T-C 20048627-T-C **
21698424-C-A 19536538-C-A **
21698420-C-A 19536534-C-A **
21602805-G-T 19440919-G-T **
21584621-T-G 19422735-T-G **
21583839-C-T 19421953-C-T **
21503288-T-C 19341402-T-C **
21367737-A-T 19205851-A-T **
21353276-C-G 19191390-C-G **
22171511-C-T 20009625-C-T **
22611307-A-G 20449421-A-G **
23475510-C-T 21313624-C-T **
23014775-C-A 20852889-C-A **
23360815-C-A 21198929-C-A **
23345681-T-C 21183795-T-C **
23288650-T-C 21126764-T-C **
23287238-T-C 21125352-T-C **
23260866-C-T 21098980-C-T **
23106000-C-T 20944114-C-T 12×T**
23098016-T-G 20936130-T-G **
23050440-A-T 20888554-A-T **
23009327-C-A 20847441-C-A **
22713120-G-T 20551234-G-T **
22991130-A-G 20829244-A-G **
22991126-A-G 20829240-A-G **
22991125-C-T 20829239-C-T **
22914654-A-C 20752768-A-C **
22854918-A-T 20693032-A-T **
22775048-G-A 20613162-G-A **
22713955-G-T 20552069-G-T **
22713813-C-A 20551927-C-A **
15971379-C-A 13859499-C-A **
15940298-C-T 13828418-C-T **
10806953-A-C **
10940591-T-A **
10976116-C-A **
10974728-C-A **
10970664-C-A **
10964537-C-T **
10964534-T-C **
10952507-T-G **
10945757-T-C **
10940338-C-A **
10983609-T-A **
10940336-C-A **
10937228-C-T **
10930425-A-C **
10921644-T-TCTAATCCATA **
10921147-A-T **
10921143-T-TCCAAGTCCCCTCCTACCCAG **
10913996-T-C **
10899317-T-C **
10980226-A-C **
10983849-C-A **
10898554-A-T **
11017259-A-T **
11030304-C-G **
11029336-C-T **
11029332-A-T **
11029288-T-G **
11027996-A-C **
11025926-TC-T **
11022445-C-A **
11018917-C-A **
11017253-T-G **
10986766-A-C **
11015785-C-A **
11013952-C-A **
11009758-C-A **
11000942-C-A **
10998518-G-A **
10996398-G-T **
10992272-A-T **
10991368-C-A **
10899271-T-A **
10898337-C-G **
11034085-T-A **
10843363-A-C **
10851195-T-C **
10851193-C-T **
10843750-C-G **
10843736-A-T **
10843734-G-T **
10843726-A-AACTACATTCCT **
10843686-C-A **
10843355-T-C **
10861895-AATTCC-A **
10832633-T-G **
10831281-C-G **
10826945-A-G **
10822253-G-T **
10947384-T-A **
10820044-C-A **
10815187-G-T **
10814632-C-A **
10861115-C-T **
10862964-C-T **
10898330-C-CTCCAT **
10880038-C-CGGATA **
10898319-A-T **
10898317-A-G **
10896460-A-T **
10896402-C-A **
10894149-C-A **
10889409-A-C **
10889182-A-C **
10888865-T-C **
10880029-G-A **
10862969-CTGATT-C **
10871034-C-T **
10870915-T-A **
10868889-A-G **
10866178-A-T **
10865854-A-C **
10865032-A-C **
10862994-C-T **
10862984-C-T **
11034049-A-T **
11034097-C-A **
15860174-C-A 13748294-C-A **
12373955-C-T **
14550747-A-G 12438948-A-G **
14539621-C-G 12427822-C-G **
14532140-C-A 12420341-C-A **
14527652-G-C 12415853-G-C **
14527629-A-T 12415830-A-T **
14526446-G-A 12414647-G-A **
12378249-C-A **
14483193-T-G 12362462-T-G **
14598789-T-C 12486989-T-C **
14463324-G-T 12342597-G-T **
14430522-A-G 12309795-A-G **
14361611-T-C 12240906-T-C **
14361610-T-A 12240905-T-A **
14348001-G-A 12227296-G-A **
14339409-T-C 12218704-T-C **
14302179-G-C 12181473-G-C **
14261573-A-C 12140867-A-C **
14571247-G-A 12459447-G-A **
14639042-A-C 12527111-A-C **
14252156-C-A 12131450-C-A **
15401158-C-A 13289278-C-A **
15834331-G-C 13722451-G-C **
15775822-A-C 13663942-A-C **
15748041-A-G 13636161-A-G **
15650569-T-C 13538689-T-C **
15475210-CG-C 13363330-CG-C **
15446837-T-A 13334957-T-A **
15435120-A-T 13323240-A-T **
15429709-G-T 13317829-G-T **
15397208-C-A 13285328-C-A **
14661377-T-G 12549442-T-G **
15332419-T-A 13220537-T-A **
15323455-A-AAT 13211573-A-AAT **
15320647-G-A 13208753-G-A **
15280659-C-T 13168758-C-T **
15128140-AC-A 13016227-AC-A **
15091772-G-A 12979861-G-A **
14721639-A-T 12609707-A-T **
14720195-C-T 12608263-C-T M7181 **
14261568-G-A 12140862-G-A **
14212560-T-G 12091854-T-G **
13199203-T-A 11043527-T-A **
13593598-C-G 11437922-C-G **
11651426-A-G **
11650702-G-T **
11650651-G-A **
11646344-A-G **
11646046-T-A **
13643503-C-T 11487827-C-T **
13643501-G-T 11487825-G-T **
13543723-A-C 11388047-A-C **
11669812-A-G **
13490501-A-C 11334825-A-C **
13490482-T-G 11334806-T-G **
13490429-T-G 11334753-T-G **
13474080-G-A 11318404-G-A **
13466390-T-G 11310714-T-G **
13267405-C-A 11111729-C-A **
13255806-C-G 11100130-C-G **
13199204-G-A 11043528-G-A **
11669566-A-G **
11670987-G-C **
14198465-C-G 12077759-C-G **
13996361-C-G 11875655-C-G **
14109543-C-G 11988837-C-G **
14056005-A-C 11935299-A-C **
14055993-T-A 11935287-T-A **
14055954-A-C 11935248-A-C **
14055882-C-A 11935176-C-A **
14007677-C-A 11886971-C-A **
14000047-C-A 11879341-C-A **
13996362-G-T 11875656-G-T **
13953535-C-A 11832829-C-A **
11673322-TA-T **
13951930-A-G 11831224-A-G **
13950161-G-T 11829455-G-T **
13945333-A-C 11824627-A-C **
13937355-C-A 11816649-C-A **
13903841-A-G 11783135-A-G **
13809243-G-C 11688537-G-C **
11677229-T-A **
11676061-C-T **
18390103-G-A 16278223-G-A P6_Gap **
16089-C-A **
10947380-T-C **
17544034-A-T 15432154-A-T *****
17065941-G-T 14954061-G-T *****
17065986-A-G 14954106-A-G ****
17087816-C-A 14975936-C-A *****
17217402-C-A 15105522-C-A *****
17225880-G-A 15114000-G-A *****
17433329-C-A 15321449-C-A ****
17483208-G-T 15371328-G-T *****
17561495-C-A 15449615-C-A *****
16719789-C-A 14607909-C-A ****
17572070-C-A 15460190-C-A *****
17629016-G-T 15517136-G-T *****
17855622-G-T 15743742-G-T *****
17902596-G-T 15790716-G-T *****
18165663-C-A 16053783-C-A *****
18166090-G-C 16054210-G-C ****
18172967-T-G 16061087-T-G *****
18194301-C-T 16082421-C-T *****
16783613-C-A 14671733-C-A ****
16702280-G-C 14590400-G-C ****
18226354-A-G 16114474-A-G *****
16320148-T-C 14208268-T-C ****
15758790-C-T 13646910-C-T *****
15834221-C-G 13722341-C-G *****
15860258-C-A 13748378-C-A *****
15901424-C-A 13789544-C-A *****
15946716-G-A 13834836-G-A *****
16047067-A-G 13935187-A-G *****
16090357-G-C 13978477-G-C *****
16279170-C-A 14167290-C-A *****
16394444-A-C 14282564-A-C *****
16692062-A-G 14580182-A-G *****
16430198-C-A 14318318-C-A *****
16462495-A-T 14350615-A-T *****
16466858-C-A 14354978-C-A ****
16515879-C-T 14403999-C-T *****
16539869-G-T 14427989-G-T *****
16575084-C-G 14463204-C-G *****
16623918-G-T 14512038-G-T *****
16677122-C-A 14565242-C-A ****
18226325-G-C 16114445-G-C ****
18534191-C-T 16422311-C-T P6_Dst *****
15435159-C-A 13323279-C-A *****
22800176-C-A 20638290-C-A ****
22204941-C-T 20043055-C-T *****
22551341-G-T 20389455-G-T *****
22611305-G-T 20449419-G-T *****
22615234-C-A 20453348-C-A *****
22615258-T-C 20453372-T-C *****
22694053-A-G 20532167-A-G ****
22713132-G-A 20551246-G-A *****
22775374-A-C 20613488-A-C *****
23061226-C-A 20899340-C-A *****
22146491-A-G 19984605-A-G *****
23096668-A-G 20934782-A-G *****
23188628-G-A 21026742-G-A *****
23287343-C-G 21125457-C-G *****
23340978-A-C 21179092-A-C *****
23355951-G-T 21194065-G-T *****
23360898-T-C 21199012-T-C ****
23449176-C-A 21287290-C-A *****
19206740-GTAAAA-G 17094860-GTAAAA-G **
22188928-T-C 20027042-T-C *****
22092735-C-A 19930849-C-A *****
18539141-A-G 16427261-A-G *****
20840374-C-A 18678488-C-A P4_Gap *****
18624480-G-T 16512600-G-T *****
18627714-C-A 16515834-C-A *****
18735318-G-A 16623438-G-A *****
18791460-A-C 16679580-A-C *****
18901051-C-A 16789171-C-A *****
19042415-C-A 16930535-C-A *****
19340415-C-A 17228535-C-A *****
19464479-G-T 17352599-G-T *****
21163161-C-A 19001275-C-A *****
22080587-G-T 19918701-G-T *****
21297816-C-A 19135930-C-A *****
21367631-C-G 19205745-C-G *****
21367733-A-G 19205847-A-G *****
21435104-C-A 19273218-C-A *****
21459863-C-A 19297977-C-A *****
21624741-C-A 19462855-C-A *****
21770720-C-A 19608834-C-A *****
21963772-T-G 19801886-T-G *****
15741552-T-C 13629672-T-C *****
15432863-A-T 13320983-A-T *****
24877528-A-T 22731381-A-T A3529 g1 **
5017726-C-A 5149685-C-A *****
6807939-C-A 6939898-C-A *****
6654935-C-A 6786894-C-A *****
6622185-G-T 6754144-G-T ****
6502956-C-A 6634915-C-A *****
6445283-G-T 6577242-G-T *****
9928692-C-A 10091083-C-A *****
5293847-A-T 5425806-A-T *****
9942960-C-G 10105351-C-G *****
4933589-G-T 5065548-G-T ****
7030559-C-A 7162518-C-A *****
4902255-T-C 5034214-T-C *****
4848871-C-T 4980830-C-T *****
4756631-C-A 4888590-C-A *****
4498641-T-C 4630600-T-C *****
4085431-C-A 4217390-C-A *****
3592834-C-A 3724793-C-A *****
3479733-G-A 3611692-G-A *****
3467631-G-T 3599590-G-T ****
6983801-T-G 7115760-T-G *****
7033537-T-A 7165496-T-A ****
10057385-C-A 10219776-C-A *****
7824889-A-T 7956848-A-T *****
7243217-C-A 7375176-C-A *****
7132012-T-G 7263971-T-G *****
7313419-T-A 7445378-T-A *****
7320320-C-A 7452279-C-A *****
7349126-C-A 7481085-C-A *****
7379715-G-T 7511674-G-T *****
7110693-C-T 7242652-C-T *****
7094426-T-C 7226385-T-C *****
7969346-G-T 8101305-G-T *****
7042924-C-A 7174883-C-A ****
7990468-C-G 8122427-C-G *****
8093364-C-T 8225323-C-T *****
8140535-G-T 8272494-G-T *****
8481069-A-T 8613028-A-T *****
8481085-A-T 8613044-A-T *****
8671489-A-T 8803448-A-T *****
8786519-C-A 8918478-C-A *****
7043170-G-T 7175129-G-T *****
3299010-C-A 3430969-C-A *****
3100095-C-A 3232054-C-A *****
15370690-G-T 13258810-G-T ****
14697084-A-G 12585150-A-G *****
14115012-T-A 11994306-T-A *****
14212257-G-C 12091551-G-C *****
14367705-C-A 12247001-C-A *****
14451327-G-T 12330600-G-T ****
14472870-C-A 12352139-C-A *****
14483214-A-C 12362483-A-C *****
14519026-A-C 12407227-A-C ****
14589365-C-T 12477565-C-T *****
14784842-A-T 12672912-A-T *****
14067066-A-G 11946360-A-G *****
14802957-C-A 12691028-C-A ****
15044323-T-C 12932413-T-C *****
15084122-T-A 12972212-T-A ****
15143614-C-A 13031701-C-A *****
15157275-T-C 13045362-T-C *****
15276638-C-A 13164727-C-A *****
15324165-C-A 13212283-C-A *****
15334800-C-A 13222918-C-A *****
14073541-C-A 11952835-C-A ****
13988962-C-T 11868256-C-T ****
3042265-G-T 3174224-G-T *****
13330062-G-A 11174386-G-A ****
2959951-C-A 3091910-C-A *****
2791208-A-G 2923167-A-G *****
2708488-G-T 2840447-G-T *****
6911377-C-A 7043336-C-A *****
13576074-C-A 11420398-C-A *****
13199101-A-G 11043425-A-G *****
13272256-C-A 11116580-C-A *****
13318012-C-A 11162336-C-A *****
13224607-C-T 11068931-C-T *****
13960758-C-A 11840052-C-A ****
13407198-G-A 11251522-G-A *****
13469536-C-T 11313860-C-T *****
13617632-G-T 11461956-G-T *****
13871948-A-G 11751242-A-G *****
10809206-T-G **
13938094-G-T 11817388-G-T *****
11030771-C-T **
13952416-C-A 11831710-C-A ****
7507103-G-T 7639062-G-T **
7200886-C-A 7332845-C-A *****
28574396-T-G 26428249-T-G *****
26100553-A-T 23954406-A-T P1_Y1 **
18534161-C-T 16422281-C-T P6_Dst **
22193870-GA-G 20031984-GA-G *****
25246610-A-T 23100463-A-T P2_r1 **
10654067-T-C **
10654068-CTCT-C **
3942640-A-AT 4074599-A-AT 10×T*****
10793237-C-A **
5358518-T-C 5490477-T-C **
4521603-C-A 4653562-C-A **
5966890-GTT-G 6098849-GTT-G 14×T*****
28631506-C-A 26485359-C-A ****
23097973-C-A 20936087-C-A *****
13962082-C-T 11841376-C-T **
7895051-TA-T 8027010-TA-T ****
10889179-C-A **
10788446-C-T **
13269925-A-C 11114249-A-C **
27862631-A-G 25716484-A-G P1_Y2 **
28772144-C-A 26625997-C-A *****
28567466-C-A 26421319-C-A *****
28549768-C-A 26403621-C-A *****
28534691-A-G 26388544-A-G *****
28660046-A-G 26513899-A-G *****
28758057-T-A 26611910-T-A *****
28758133-T-C 26611986-T-C ****
13255809-T-G 11100133-T-G 12×G**
9310579-C-T 9472970-C-T **
58986750-C-A 56840603-C-A *****
8712851-C-A 8844810-C-A Z28064 *****
58862761-G-A 56728110-C-T *****
4267560-TTC-T 4399519-TTC-T ****
10064091-A-G 10226482-A-G **
10064055-G-A 10226446-G-A **
14213828-G-A 12093122-G-A **
21891100-CA-C 19729214-CA-C 9×A**
19318177-TC-T 17206297-TC-T **
19286341-T-C 17174461-T-C Z20466 **
24904700-AG-A 22758553-AG-A g1 **
6816736-C-T 6948695-C-T *****
10668575-A-C **
4521597-G-A 4653556-G-A **
24278333-A-AGGG 22132186-A-AGGG P3_b1 **
7201554-T-C 7333513-T-C **
26046021-G-T 23899874-G-T P1_Y1 **
13199199-A-C 11043523-A-C **
10941220-G-C **
16506873-T-TA 14394993-T-TA 9×A**
22956140-T-C 20794254-T-C **
10748250-A-ACCATT **
17633685-AC-A 15521805-AC-A **
16147492-G-A 14035612-G-A P8_Dst **
10974039-T-C **
17231485-C-A 15119605-C-A *****
9952537-C-T 10114928-C-T **
2718903-GA-G 2850862-GA-G **
10877859-A-G **
10759879-A-C **
20888622-G-C 18726736-G-C P4_Dst **
10817633-G-T **
13263371-CAGC-TAGG 11107695-CAGC-TAGG ***
27527178-C-A 25381031-C-A P1_Y2 ***
25054364-C-T 22908217-C-T g1 ***
58912635-G-C 56678236-C-G ***
13461435-C-G 11305759-C-G ***
13299976-A-C 11144300-A-C ***
58891035-GCAT-CTAA 56699833-ATGC-TTAG 4×CATTC***
22334409-A-C 20172523-A-C DYZ19 ***
22501937-A-C 20340051-A-C DYZ19 ***
13744885-C-T 11589209-C-T ***
13485890-CCCA-ACC 11330214-CCCA-ACC ***
13320070-A-T 11164394-A-T ***
13332303-C-A 11176627-C-A ***
13196388-C-A 11040712-C-A ***
10064129-T-G 10226520-T-G ***
13543218-A-G 11387542-A-G ***
24177697-T-TTG 22031550-T-TTG P3_b1 17×TG******
17277481-T-TCA 15165601-T-TCA 20×CA***
10063382-T-C 10225773-T-C ***
13744999-C-T 11589323-C-T ***
24654520-A-G 22508373-A-G P3_b2 ***
13460477-A-T 11304801-A-T ***
13326039-G-A 11170363-G-A ***
9323493-C-G 9485884-C-G ***
22431818-G-T 20269932-G-T DYZ19 ***
13320112-A-G 11164436-A-G ***
58858959-CTCTATC-TTCCATT 56731906-GATAGAG-AATGGAA ***
13433217-A-G 11277541-A-G ***
22360196-C-A 20198310-C-A DYZ19 ***
58982012-GTGCCAC-ATGTCAA 56835865-GTGCCAC-ATGTCAA ***
10063382-TG-CA 10225773-TG-CA ***
6319373-G-A 6451332-G-A IR3_Dst ***
10071073-C-A 10233464-C-A ***
22431801-T-A 20269915-T-A DYZ19 ***
58912416-A-C 56678455-T-G ***
25466379-T-A 23320232-T-A P2_r2 ***
28008591-C-CA 25862444-C-CA P1_Y2 11×A***
25110099-G-A 22963952-G-A g1 ***
22337965-A-C 20176079-A-C DYZ19 ***
26905497-CAA-C 24759350-CAA-C P1_r3 19×A***
4282199-C-A 4414158-C-A ***
4585877-C-T 4717836-C-T ***
13739635-A-T 11583959-A-T ***
58883954-A-G 56706917-T-C ***
58858773-A-T 56732098-T-A ***
5579803-C-A 5711762-C-A ***
5785633-C-A 5917592-C-A ***
6092491-C-A 6224450-C-A ***
6232286-C-A 6364245-C-A IR3_Dst ***
6323398-A-C 6455357-A-C IR3_Dst ***
28791259-C-A 26645112-C-A ***
3274723-C-A 3406682-C-A ***
13321117-G-A 11165441-G-A ***
25628466-G-T 23482319-G-T P1_b3 ***
13487151-C-T 11331475-C-T FGC58454 ***
56843522-C-A ***
28791280-A-G 26645133-A-G A4504 ***
7093236-T-G 7225195-T-G ***
56847053-C-T ***
58882865-C-T 56708006-G-A ***
27320941-A-AT 25174794-A-AT P1_g3 11×T***
56851618-T-C ***
17189375-G-A 15077495-G-A ***
58858775-T-C 56732096-A-G ***
28370015-T-TAG 26223868-T-TAG P1_gr2 16×AG***
10063723-A-T 10226114-A-T ***
10063776-A-C 10226167-A-C ***
10063734-A-T 10226125-A-T ***
10063761-T-G 10226152-T-G ***
13460687-G-A 11305011-G-A ***
22267544-A-G 20105658-A-G DYZ19 ***
58999396-G-T 56853249-G-T ***
58989875-C-T 56843728-C-T ***
14384631-T-A 12263927-T-A ***
13332277-C-T 11176601-C-T ***
10063778-G-A 10226169-G-A ***
13132246-A-G 10621732-A-G ***
10063762-G-C 10226153-G-C ***
14331182-C-T 12210476-C-T ***
22277772-T-C 20115886-T-C ZS4707 DYZ19 ***
58983182-CTAC-GCAT 56837035-CTAC-GCAT ***
9931411-A-G 10093802-A-G ***
13460578-T-A 11304902-T-A ***
24711544-GT-G 22565397-GT-G P3_b2 11×T***
19646890-C-CT 17535010-C-CT P5_Prx 11×T***
26992936-C-T 24846789-C-T P1_r4 ***
58985904-T-A 56839757-T-A ***
22342356-A-T 20180470-A-T DYZ19 ***
13461451-C-G 11305775-C-G ***
14077168-C-A 11956462-C-A ***
2758718-C-A 2890677-C-A ***
7113261-G-T 7245220-G-T ***
25537117-G-GT 23390970-G-GT P1_gr1 10×T***
10048503-A-G 10210894-A-G ***
58841046-C-A 56749825-G-T ***
9577007-C-A 9739398-C-A IR3_Prx ***
9540266-A-G 9702657-A-G IR3_Prx ***
22342344-C-A 20180458-C-A DYZ19 ***
13684447-T-A 11528771-T-A ***
9977458-A-T 10139849-A-T ***
22431808-T-C 20269922-T-C DYZ19 ***
19546149-G-A 17434269-G-A ***
19187495-C-T 17075615-C-T ***
13132226-G-C 10621712-G-C ***
13132206-G-C 10621692-G-C ***
58973713-C-T 56827566-C-T ***
10037619-C-T 10200010-C-T A18565 ***
10037620-A-G 10200011-A-G ***
58863083-A-C 56727788-T-G ***
10048523-A-T 10210914-A-T ***
9944912-T-A 10107303-T-A ***
7167159-T-A 7299118-T-A ***
22340041-G-A 20178155-G-A DYZ19 ***
25417491-A-T 23271344-A-T P2_r2 ***
25440081-C-T 23293934-C-T P2_r2 ***
58838619-C-G 56752252-G-C ***
58838681-A-G 56752190-T-C ***
58873125-T-G 56717746-A-C ***
9943775-G-GAAA 10106166-G-GAAA ***
22234785-TCTG-ACTA 20072899-TCTG-ACTA DYZ19 ***
14067620-TAC-T 11946914-TAC-T ***
13711978-C-T 11556302-C-T ***
13490563-G-A 11334887-G-A ***
10048514-A-G 10210905-A-G ***
13718334-T-A 11562658-T-A ***
10071278-T-C 10233669-T-C ***
9944617-CTT-C 10107008-CTT-C ***
58844561-C-A 56746310-G-T ***
22504082-CCAGT-GCAGA 20342196-CCAGT-GCAGA DYZ19 ***
13132235-G-A 10621721-G-A ***
22421191-G-A 20259305-G-A DYZ19 ***
22234403-G-A 20072517-G-A DYZ19 ***
22277808-A-G 20115922-A-G DYZ19 ***
22277811-A-T 20115925-A-T DYZ19 ***
22277828-A-C 20115942-A-C DYZ19 ***
20892284-C-A 18730398-C-A FGC14545 P4_Dst 9×A***
18831702-G-A 16719822-G-A ***
22309924-G-T 20148038-G-T DYZ19 ***
25323046-A-G 23176899-A-G P2_r1 ***
13469978-C-G 11314302-C-G ***
9944637-TG-T 10107028-TG-T ***
22340054-G-A 20178168-G-A JN96 DYZ19 ***
10071117-G-A 10233508-G-A ***
10063420-G-GT 10225811-G-GT ***
10063424-A-T 10225815-A-T ***
24595421-C-T 22449274-C-T P3_t2 ***
18855427-T-C 16743547-T-C ***
22431886-C-A 20270000-C-A DYZ19 ***
14429405-TTATATA-T 12308680-TTATA-T 15×TA***
9218522-TTGTGTG-T,TTG 9380913-TTGTGTG-T,TTG 12×TG***
13481937-C-A 11326261-C-A ***
9920473-GC-TT 10082864-GC-TT ***
9324835-C-T 9487226-C-T ***
10068075-TGTTG-CGTTT 10230466-TGTTG-CGTTT ***
16519316-CAAAA-C 14407436-CAAAA-C 15×A***
10021449-C-T 10183840-C-T ***
10071295-A-C 10233686-A-C ***
10071252-G-A 10233643-G-A ***
10063473-T-C 10225864-T-C ***
27016219-A-T 24870072-A-T P1_r4 ***
6403564-ATAT-GTAC 6535523-ATAT-GTAC ***
25446036-A-T 23299889-A-T P2_r2 ***
9369169-A-T 9531560-A-T ***
13323338-T-A 11167662-T-A ***
58976984-C-A,T 56830837-C-A,T ***
9962556-G-A 10124947-G-A ***
21946458-T-C,G 19784572-T-C,G ***
13846940-TAT-GAA 11726234-TAT-GAA ***
26880358-A-C 24734211-A-C P1_r3 ***
22322106-T-G 20160220-T-G DYZ19 ***
9920519-CAAAGAAAG-TAAACAAAT 10082910-CAAAGAAAG-TAAACAAAT ***
22364761-CT-TG 20202875-CT-TG DYZ19 ***
13855066-AGAG-GGAA 11734360-AGAG-GGAA ***
9944566-CT-AC 10106957-CT-AC ***
22431410-T-G 20269524-T-G DYZ19 ***
9540282-G-T 9702673-G-T IR3_Prx ***
22502126-T-G 20340240-T-G DYZ19 ***
59021583-ATAAT-GTAA 56875436-ATAAT-GTAA ***
58837619-C-T 56753252-G-A ***
26880327-A-T 24734180-A-T P1_r3 ***
13734783-TTCAAAT-CTGAAAC 11579107-TTCAAAT-CTGAAAC ***
58985891-CCTACAT-GCCACAG 56839744-CCTACAT-GCCACAG ***
9909078-A-G 10071469-A-G ***
13460805-T-C 11305129-T-C ***
22972997-T-C 20811111-T-C ***
58891003-T-C 56699868-A-G ***
10071145-T-A 10233536-T-A ***
10071114-G-A 10233505-G-A ***
13846883-CGGAC-TGGAT 11726177-CGGAC-TGGAT ***
13859590-GAACAGATTCG-AAACGGACTC 11738884-GAACAGATTCG-AAACGGACTC ***
10071223-T-C 10233614-T-C ***
10071258-A-G 10233649-A-G ***
10071193-C-A 10233584-C-A ***
10064115-T-A 10226506-T-A ***
10064070-G-T 10226461-G-T ***
10063823-G-A 10226214-G-A ***
22234795-CAAAT-AAAAC 20072909-CAAAT-AAAAC DYZ19 ***
10063453-C-T 10225844-C-T ***
58838647-ATCCT-TTCCG 56752220-AGGAT-CGGAA ***
58838656-ATTGCAG-GTTTGAT 56752209-CTGCAAT-ATCAAAC ***
10048484-A-G 10210875-A-G ***
10037590-T-C 10199981-T-C ***
10037604-A-T 10199995-A-T ***
13196367-C-G 11040691-C-G ***
9924574-G-C 10086965-G-C ***
22431366-A-T 20269480-A-T DYZ19 ***
19700266-T-A 17588386-T-A P5_Prx ***
28819318-A-T 26673171-A-T ***
13460602-CAA-AAC 11304926-CAA-AAC ***
15733965-T-C 13622085-T-C ***
22481833-G-C 20319947-G-C DYZ19 ***
10042410-A-T 10204801-A-T ***
10014886-C-T 10177277-C-T ***
15491980-C-T 13380100-C-T Y33438 ***
9920561-A-G 10082952-A-G ***
9920527-G-T 10082918-G-T ***
9920519-C-T 10082910-C-T ***
9952019-AT-A 10114410-AT-A ***
9920580-T-C 10082971-T-C ***
27435279-AGT-A 25289132-AGT-A P1_g3 11×GT***
22234267-AAGAAAT-TAGTAAC 20072381-AAGAAAT-TAGTAAC DYZ19 ***
13729554-C-G 11573878-C-G ***
10780664-C-G ***
7172242-C-T 7304201-C-T ALK120 ***
58908830-C-A 56682041-G-T ***
27714511-G-T 25568364-G-T P1_Y2 ***
27841969-C-A 25695822-C-A P1_Y2 ***
27916422-C-A 25770275-C-A P1_Y2 ***
27916430-T-A 25770283-T-A P1_Y2 ***
27994928-A-G 25848781-A-G P1_Y2 ***
28204106-A-T 26057959-A-T P1_b4 ***
28234302-A-T 26088155-A-T P1_b4 ***
28556329-G-T 26410182-G-T ***
28567393-G-T 26421246-G-T ***
28791275-G-C 26645128-G-C ***
28791307-G-A 26645160-G-A ***
28804054-C-A 26657907-C-A ***
58891006-C-T 56699865-G-A ***
58891015-C-G 56699856-G-C ***
58908849-C-A 56682022-G-T ***
27289694-G-T 25143547-G-T P1_g3 ***
58908862-T-C 56682009-A-G ***
2845950-T-C 2977909-T-C ***
58912617-C-A 56678254-G-T ***
21464556-G-AA 19302670-G-AA ***
2768043-TACAG-T 2900002-TACAG-T ***
19693510-AT-A 17581630-AT-A P5_Prx 12×T***
9923867-AT-GA 10086258-AT-GA ***
13705584-TA-AG 11549908-TA-AG ***
5059692-GACT-CACC 5191651-GACT-CACC ***
6780897-C-AA 6912856-C-AA ***
8479399-CTTTTT-C 8611358-CTTTTT-C 18×T***
9474544-CA-C 9636935-CA-C ***
9916198-GT-AA 10078589-GT-AA ***
9916210-C-CTGAGATAGTT 10078601-C-CTGAGATAGTT ***
27337977-G-A 25191830-G-A P1_g3 ***
27262724-G-A 25116577-G-A P1_g3 ***
9916277-CTTT-C 10078668-CTTT-C ***
26880361-A-T 24734214-A-T P1_r3 ***
25677297-C-T 23531150-C-T P1_b3 ***
25699320-G-T 23553173-G-T P1_b3 ***
26032791-C-A 23886644-C-A P1_Y1 ***
26105783-C-T 23959636-C-T P1_Y1 ***
4561176-TAACCTCGACCCAAATAATCTATAACA-T 4693135-TAACCTCGACCCAAATAATCTATAACA-T ***
26219813-T-A 24073666-T-A P1_Y1 ***
26308622-C-A 24162475-C-A P1_Y1 ***
26462979-T-C 24316832-T-C P1_Y1 ***
26580614-G-T 24434467-G-T P1_g2 ***
26594387-A-C 24448240-A-C P1_g2 ***
26874067-C-A 24727920-C-A P1_r3 ***
26874719-G-A 24728572-G-A P1_r3 ***
26880267-G-T 24734120-G-T P1_r3 ***
26880343-A-T 24734196-A-T P1_r3 ***
26880363-A-C 24734216-A-C P1_r3 ***
27186316-C-A 25040169-C-A P1_g3 ***
26880365-G-T 24734218-G-T P1_r3 ***
26880374-A-T 24734227-A-T P1_r3 ***
26880435-G-C 24734288-G-C P1_r3 ***
26887082-G-T 24740935-G-T P1_r3 ***
26888460-A-T 24742313-A-T P1_r3 ***
26906653-T-C 24760506-T-C P1_r3 ***
26948608-C-A 24802461-C-A P1_r3 ***
26990961-A-C 24844814-A-C P1_r4 ***
26990974-G-T 24844827-G-T P1_r4 ***
26990989-A-G 24844842-A-G P1_r4 ***
26991237-T-A 24845090-T-A P1_r4 ***
27016224-G-T 24870077-G-T P1_r4 ***
27127696-A-T 24981549-A-T P1_g3 ***
27154710-G-T 25008563-G-T P1_g3 ***
9916262-AAA-CAG 10078653-AAA-CAG ***
9920498-CTGTT-TTGTC 10082889-CTGTT-TTGTC ***
25628726-G-T 23482579-G-T P1_b3 ***
16406873-TG-T 14294993-TG-T ***
28567333-AT-A 26421186-AT-A 13×T***
27829232-C-T 25683085-C-T P1_Y2 ***
58862760-CG-AA 56728110-CG-TT ***
18019855-G-T 15907975-G-T ***
58883943-TATC-CATT 56706925-GATA-AATG ***
58891054-TCCAT-GCCAC 56699813-ATGGA-GTGGC ***
10947623-ATTCTA-A,ATTCT ***
58908842-TCCCAT-CTCCAC 56682024-ATGGGA-GTGGAG ***
2730114-G-A 2862073-G-A ***
56847372-G-T ***
58970174-AA-T 56824027-AA-T ***
58976367-TTCCC-CTCCA 56830220-TTCCC-CTCCA ***
13488534-G-T 11332858-G-T ***
15279206-GTTT-G 13167305-GTTT-G 13×T***
13213820-CGGATGGAT-C,CGGAT 11058144-CGGATGGAT-C,CGGAT 10×GGAT***
27016157-CC-TT 24870010-CC-TT P1_r4 ***
10653096-T-C ***
10653108-C-G ***
9398059-C-A 9560450-C-A ***
13487696-T-A 11332020-T-A ***
16905870-CAAA-C 14793990-CAAA-C 25×A***
10980707-T-A ***
15047588-C-A 12935679-C-A ***
10756129-C-T ***
16768530-T-A 14656650-T-A ***
10682636-A-T ***
10958335-A-G ***
10744349-C-G ***
10776065-CGCTCCACTCA-C,CATTCCATTCA ***
17678647-TG-T 15566767-TG-T ***
27095986-GTA-TTT 24949839-GTA-TTT P1_r4 ***
26283209-CAA-C 24137062-CAA-C P1_Y1 21×A***
9920578-ACT-GCC 10082969-ACT-GCC ***
13737509-GATTG-AATTC 11581833-GATTG-AATTC ***
9920618-CC-GT 10083009-CC-GT ***
9924546-ACAC-TCAA 10086937-ACAC-TCAA ***
13454742-C-A 11299066-C-A ***
9924554-CAGAG-AAAAT 10086945-CAGAG-AAAAT ***
9930096-GG-AA 10092487-GG-AA ***
10037786-GGCTC-AGCTT 10200177-GGCTC-AGCTT ***
10043209-AA-GG 10205600-AA-GG ***
10063453-CGACAG-TGACT 10225844-CGACAG-TGACT ***
10068056-AAG-TAT 10230447-AAG-TAT ***
10072025-AGGA-GGGC 10234416-AGGA-GGGC ***
10072047-CCC-TCA 10234438-CCC-TCA ***
10086271-CCATA-ACATT 10248662-CCATA-ACATT ***
13460649-TCC-CCT 11304973-TCC-CCT ***
13461249-TATGT-AATGC 11305573-TATGT-AATGC ***
13809254-GAATAT-AAATGG 11688548-GAATAT-AAATGG ***
25096454-A-AAAGC 22950307-A-AAAGC g1 ***
4070062-C-A 4202021-C-A ***
24325455-A-AT 22179308-A-AT P3_t1 11×T***
24013786-CATGG-TATGT 21867639-CATGG-TATGT ***
23471037-T-A 21309151-T-A ***
22504487-CGTT-AGTG 20342601-CGTT-AGTG DYZ19 ***
22324931-TCAT-GCAC 20163045-TCAT-GCAC DYZ19 ***
22113187-CAAA-C 19951301-CAAA-C 23×A***
21639038-TAAA-T 19477152-TAAA-T 25×A***
13842646-C-CGGAATGGAAT 11721940-C-CGGAATGGAAT 12×GGAAT***
21386171-TTA-T 19224285-TTA-T ***
19948181-CCTTTCTTT-C 17836301-CCTTTCTTT-C P5_Prx 21×CTTT***
18325701-ATTTT-A 16213821-ATTTT-A P6_Prx 27×T***
17672318-GAAAAA-G 15560438-GAAAAA-G 16×A***
17663107-CAAG-AAAA 15551227-CAAG-AAAA ***
14391874-TAAAAAA-T 12271170-TAAAAAA-T 15×A***
25651206-T-A 23505059-T-A P1_b3 ***
25626745-G-A 23480598-G-A P1_b3 ***
7270341-A-G 7402300-A-G ***
13421471-C-G 11265795-C-G ***
10063458-G-T 10225849-G-T ***
10063719-T-C 10226110-T-C ***
10063752-G-C 10226143-G-C ***
10068058-G-T 10230449-G-T ***
10072036-T-C 10234427-T-C ***
10072073-T-C 10234464-T-C ***
10086268-C-A 10248659-C-A ***
10086355-C-T 10248746-C-T ***
13114746-T-A 10604232-T-A ***
13132244-C-T 10621730-C-T ***
13132248-G-A 10621734-G-A ***
13132280-T-C 10621766-T-C ***
13395224-C-G 11239548-C-G ***
13395236-C-A 11239560-C-A ***
13421495-C-T 11265819-C-T ***
10048504-C-T 10210895-C-T ***
13433800-C-T 11278124-C-T ***
13446072-G-A 11290396-G-A ***
13460841-A-C 11305165-A-C ***
13510078-T-C 11354402-T-C ***
13521512-A-C 11365836-A-C ***
13729758-T-A 11574082-T-A ***
13733676-T-G 11578000-T-G ***
13733686-T-A 11578010-T-A ***
26089061-C-A 23942914-C-A P1_Y1 20×A***
13740321-T-G 11584645-T-G ***
13744989-T-C 11589313-T-C ***
13745001-G-A 11589325-G-A ***
10756119-T-TTTAAC ***
10756103-A-G ***
10048520-G-A 10210911-G-A ***
10043846-G-A 10206237-G-A ***
10755388-ACTCATCTCTGTTTCATTCCG-A,ACTCCTCTCTGTTCCATTCCG ***
9920507-A-C 10082898-A-C ***
7466561-C-A 7598520-C-A IR1_L ***
7493850-A-T 7625809-A-T IR1_L ***
11003677-C-A ***
8793012-A-C 8924971-A-C ***
9166864-T-G 9329255-T-G ***
9209009-G-T 9371400-G-T ***
9354950-A-G 9517341-A-G ***
9540270-T-C 9702661-T-C IR3_Prx ***
9540292-C-T 9702683-C-T IR3_Prx ***
9731848-C-G 9894239-C-G IR3_Prx ***
9916163-A-G 10078554-A-G ***
9916247-T-A 10078638-T-A ***
9916257-T-A 10078648-T-A ***
9916297-A-T 10078688-A-T ***
9920593-T-A 10082984-T-A ***
10043821-T-C 10206212-T-C ***
9924567-C-G 10086958-C-G ***
9924584-G-C 10086975-G-C ***
9924611-C-A 10087002-C-A ***
9931448-G-A 10093839-G-A ***
9943740-G-C 10106131-G-C ***
9944900-G-T 10107291-G-T ***
9945452-T-C 10107843-T-C ***
9945458-A-G 10107849-A-G ***
9945467-C-T 10107858-C-T ***
9947666-G-T 10110057-G-T ***
10043063-C-T 10205454-C-T ***
10043237-T-C 10205628-T-C ***
10043265-T-C 10205656-T-C ***
10043794-T-A 10206185-T-A ***
10756078-A-T ***
10744381-G-C,T ***
25602263-T-A 23456116-T-A P1_gr1 ***
24028294-G-A 21882147-G-A ***
22421090-G-T 20259204-G-T DYZ19 ***
22421109-G-T 20259223-G-T DYZ19 ***
22421121-G-T 20259235-G-T DYZ19 ***
22433116-T-A 20271230-T-A DYZ19 ***
22481826-G-C 20319940-G-C DYZ19 ***
22488858-T-G 20326972-T-G DYZ19 ***
22493065-G-C 20331179-G-C DYZ19 ***
22537329-C-A 20375443-C-A ***
23682279-G-T 21520393-G-T ***
23810486-C-A 21648600-C-A ***
23831335-T-C 21669449-T-C ***
23879996-G-A 21718110-G-A ***
24013816-G-A 21867669-G-A ***
24013834-T-A 21867687-T-A ***
24038362-G-A 21892215-G-A ***
22334517-A-C 20172631-A-C DYZ19 ***
24353293-T-A 22207146-T-A P3_t1 ***
24587621-C-A 22441474-C-A P3_t2 ***
24696149-A-G 22550002-A-G P3_b2 ***
25223790-A-C 23077643-A-C P2_r1 ***
25223947-G-A 23077800-G-A P2_r1 ***
25228196-G-T 23082049-G-T P2_r1 ***
25273912-A-T 23127765-A-T P2_r1 ***
25296562-A-T 23150415-A-T P2_r1 ***
25369409-A-T 23223262-A-T P2_r2 ***
25380279-T-G 23234132-T-G P2_r2 ***
25446052-C-T 23299905-C-T P2_r2 ***
25466404-T-G 23320257-T-G P2_r2 ***
4919329-G-T 5051288-G-T ***
25592624-C-A 23446477-C-A P1_gr1 ***
22334529-C-A 20172643-C-A DYZ19 ***
22327188-G-T 20165302-G-T DYZ19 ***
14785522-C-T 12673592-C-T ***
7040196-G-T 7172155-G-T ***
10677750-AC-A ***
10676941-C-A ***
9978958-C-A 10141349-C-A ***
16015243-A-G 13903363-A-G ***
16104925-C-A 13993045-C-A P8_Prx ***
16136115-G-T 14024235-G-T P8_Dst ***
16136116-C-A 14024236-C-A P8_Dst ***
8550834-T-G 8682793-T-G ***
8398986-TG-T 8530945-TG-T ***
17591815-A-G 15479935-A-G ***
17629764-C-A 15517884-C-A ***
17994782-G-T 15882902-G-T P7_Prx ***
18443075-A-T 16331195-A-T P6_Dst ***
18565029-T-A 16453149-T-A ***
7040029-G-T 7171988-G-T ***
22301151-T-C 20139265-T-C DYZ19 ***
20732251-C-A 18570365-C-A P4_Prx ***
22235316-C-A 20073430-C-A DYZ19 ***
22222703-G-T 20060817-G-T DYZ19 ***
21170314-G-A 19008428-G-A ***
20947502-A-C 18785616-A-C P4_Dst ***
20931406-C-T 18769520-C-T P4_Dst ***
20744673-C-A 18582787-C-A P4_Prx ***
20384647-T-A 18222761-T-A P5_Dst ***
19594580-A-G 17482700-A-G P5_Prx ***
20142918-T-G 18031038-T-G P5_Dst ***
19860888-C-A 17749008-C-A P5_Prx ***
19773539-C-A 17661659-C-A P5_Prx ***
19700272-T-A 17588392-T-A P5_Prx ***
19647567-A-T 17535687-A-T P5_Prx ***
19620655-C-T 17508775-C-T P5_Prx ***
10685772-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page