Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > Z30233 > FGC3903/S5201 > S5199 > Z246 > DF25 > DF5 > ZZ32 > L1403 > L1402 > A818 > A426 > A12131 > A7493 > A7495 > 19093923-G-A

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
639611
BigY2
639611
19760574-C-T 17648694-C-T P5_Prx ***A*
13698456-T-C 11542780-T-C A*
22574759-G-A 20412873-G-A BY139190 YY++
17652519-C-T 15540639-C-T BY116363 YY++
17660631-T-A 15548751-T-A BY54973 YY++
19021728-G-T 16909848-G-T BY125573 YY++
21231293-G-T 19069407-G-T BY131287 YY++
22465346-C-G 20303460-C-G DYZ19 ++
6916825-T-G 7048784-T-G BY25994 Y**+
56848289-A-G **
16041852-T-C 13929972-T-C **
16041902-A-C 13930022-A-C **
16016964-C-T 13905084-C-T **
16008980-T-C 13897100-T-C **
16006963-C-A 13895083-C-A **
15944028-A-T 13832148-A-T **
15928718-AAAAG-A 13816838-AAAAG-A **
15823593-G-A 13711713-G-A **
16041921-T-A 13930041-T-A **
16044894-T-A 13933014-T-A **
15790475-C-G 13678595-C-G **
16354251-C-A 14242371-C-A **
16562791-A-G 14450911-A-G **
16492883-A-T 14381003-A-T **
16490826-G-T 14378946-G-T **
16476347-C-A 14364467-C-A **
16428115-A-T 14316235-A-T **
16427359-T-G 14315479-T-G **
16379112-C-A 14267232-C-A **
16340970-C-A 14229090-C-A **
16062922-G-T 13951042-G-T **
16317508-G-T 14205628-G-T **
16267361-A-G 14155481-A-G **
16232441-T-G 14120561-T-G **
16172135-G-T 14060255-G-T **
16085646-T-A 13973766-T-A **
16084074-G-A 13972194-G-A **
16072969-G-T 13961089-G-T **
15793037-T-C 13681157-T-C **
15745964-C-A 13634084-C-A **
15777061-T-A 13665181-T-A **
15658182-A-T 13546302-A-T **
15323654-G-T 13211772-G-T **
15342478-G-C 13230597-G-C **
15376122-C-T 13264242-C-T **
15376176-G-T 13264296-G-T **
15376219-G-T 13264339-G-T **
15376255-A-G 13264375-A-G **
15576497-T-G 13464617-T-G **
15579952-A-G 13468072-A-G **
15619434-A-T 13507554-A-T **
15636132-C-A 13524252-C-A **
15641762-G-T 13529882-G-T **
15641765-G-C 13529885-G-C **
15665688-C-A 13553808-C-A **
15770746-G-A 13658866-G-A **
15670243-A-T 13558363-A-T **
15677168-C-G 13565288-C-G **
15677175-C-T 13565295-C-T **
15680141-T-G 13568261-T-G **
15680142-T-A 13568262-T-A **
15697108-T-G 13585228-T-G **
15700941-A-C 13589061-A-C **
15700952-A-C 13589072-A-C **
15700964-A-T 13589084-A-T **
15701025-C-T 13589145-C-T **
15712373-A-C 13600493-A-C **
15748142-G-T 13636262-G-T **
15756459-A-G 13644579-A-G **
16700388-G-T 14588508-G-T **
16814902-T-A 14703022-T-A **
16717348-G-T 14605468-G-T **
18185351-T-G 16073471-T-G **
17850102-G-T 15738222-G-T **
17863417-T-C 15751537-T-C **
17884543-C-G 15772663-C-G **
17947048-C-A 15835168-C-A **
18035698-GA-G 15923818-GA-G **
18037922-T-C 15926042-T-C **
18040791-C-G 15928911-C-G **
18153709-C-G 16041829-C-G **
18154318-T-C 16042438-T-C **
18154329-A-T 16042449-A-T **
18154351-A-T 16042471-A-T **
18184002-A-C 16072122-A-C **
18194385-G-T 16082505-G-T **
17749260-C-A 15637380-C-A **
18241876-C-T 16129996-C-T **
18299818-T-A 16187938-T-A P6_Prx **
18299828-T-C 16187948-T-C P6_Prx **
18299838-C-T 16187958-C-T P6_Prx **
18299854-G-C 16187974-G-C P6_Prx **
18299859-T-G 16187979-T-G P6_Prx **
18299879-T-C 16187999-T-C P6_Prx **
18325607-C-A 16213727-C-A P6_Prx **
18325678-C-A 16213798-C-A P6_Prx **
18346378-G-T 16234498-G-T P6_Prx **
18370870-T-C 16258990-T-C P6_Prx **
18463391-A-G 16351511-A-G P6_Dst **
18463450-A-AG 16351570-A-AG P6_Dst **
17752032-G-A 15640152-G-A **
17735504-G-C 15623624-G-C **
16777849-C-G 14665969-C-G **
17136986-C-T 15025106-C-T **
16777940-A-C 14666060-A-C **
16777971-T-A 14666091-T-A **
15270919-G-T 13159008-G-T **
16816319-T-G 14704439-T-G **
16816461-T-C 14704581-T-C **
16860760-A-AC 14748880-A-AC **
16897630-C-T 14785750-C-T **
16922257-A-T 14810377-A-T **
16926463-G-T 14814583-G-T **
16933170-C-A 14821290-C-A **
17097426-C-T 14985546-C-T **
17117375-A-T 15005495-A-T **
17117473-G-C 15005593-G-C **
17196519-A-G 15084639-A-G **
17707371-C-A 15595491-C-A **
17225903-A-T 15114023-A-T **
17269565-G-T 15157685-G-T **
17269663-A-G 15157783-A-G **
17269748-A-C 15157868-A-C **
17277410-A-C 15165530-A-C **
17278080-A-G 15166200-A-G **
17448245-C-T 15336365-C-T **
17448255-T-A 15336375-T-A **
17464932-A-G 15353052-A-G **
17491990-G-T 15380110-G-T **
17503795-A-C 15391915-A-C **
17569265-A-C 15457385-A-C **
17682649-G-T 15570769-G-T **
15323652-A-G 13211770-A-G **
14962460-T-C 12850535-T-C **
15218893-T-A 13106979-T-A **
13290967-C-A 11135291-C-A **
10984020-C-T **
11000776-T-C **
11003158-C-A **
11009785-A-T **
11014902-G-C **
11014981-G-C **
11022825-A-T **
13202037-A-T 11046361-A-T **
13208121-A-G 11052445-A-G **
13249562-G-A 11093886-G-A **
13249577-C-G 11093901-C-G **
13253283-G-A 11097607-G-A **
13323236-C-T 11167560-C-T **
10974576-C-A **
13441574-A-G 11285898-A-G **
13469579-A-G 11313903-A-G **
13469597-C-G 11313921-C-G **
13469604-C-A 11313928-C-A **
13490413-A-C 11334737-A-C **
13494538-A-T 11338862-A-T **
13494545-C-A 11338869-C-A **
13518512-C-A 11362836-C-A **
13586076-T-A 11430400-T-A **
13603077-G-C 11447401-G-C **
13620375-T-C 11464699-T-C **
13642966-G-A 11487290-G-A **
13643508-T-G 11487832-T-G **
10983032-A-C **
10971363-G-T **
13644096-G-A 11488420-G-A **
10921187-A-C **
10797392-C-A **
10801121-A-T **
10801238-A-G **
10841285-T-G **
10849475-C-A **
10864582-T-G **
10864622-T-A **
10864665-A-C **
10864739-A-T **
10884886-C-A **
10898367-C-A **
10913550-G-A **
10924847-C-A **
10967362-A-T **
10933847-C-T **
10933854-T-A **
10933890-T-A **
10933909-T-A **
10934015-C-A **
10935667-A-C **
10938494-C-A **
10939723-A-C **
10944309-C-T **
10946416-C-A **
10952248-T-A **
10958267-G-C **
10959105-G-C **
13643521-T-C 11487845-T-C **
13710680-T-G 11555004-T-G **
15168839-C-T 13056925-C-T **
14563409-C-T 12451609-C-T **
14359918-T-C 12239213-T-C **
14361567-G-C 12240862-G-C **
14361600-A-C 12240895-A-C **
14424970-A-C 12304245-A-C **
14457585-C-A 12336858-C-A **
14463597-T-C 12342870-T-C **
14467690-T-G 12346959-T-G **
14508752-T-C 12396957-T-C **
14518413-C-G 12406614-C-G **
14526781-A-C 12414982-A-C **
14550189-A-G 12438390-A-G **
14557696-C-T 12445897-C-T **
14590541-G-C 12478741-G-C **
14316370-T-A 12195664-T-A **
14607453-G-T 12495655-G-T **
14688702-C-T 12576768-C-T **
14720438-A-C 12608506-A-C **
14761281-A-G 12649350-A-G **
14795158-C-A 12683229-C-A **
14798672-C-A 12686743-C-A **
14909617-T-A 12797684-T-A **
14962376-C-T 12850451-C-T **
14962424-A-T 12850499-A-T **
14962435-A-T 12850510-A-T **
18611668-G-A 16499788-G-A **
15093611-A-T 12981699-A-T **
15115476-T-C 13003563-T-C **
14316371-G-T 12195665-G-T **
14316266-T-G 12195560-T-G **
13718239-T-G 11562563-T-G **
13907280-G-T 11786574-G-T **
13723091-T-A 11567415-T-A **
11646203-G-T **
11652074-T-A **
11654855-T-A **
11656874-A-G **
11669710-G-T **
11671046-C-A **
13801422-T-C 11680716-T-C **
13809284-G-T 11688578-G-T **
13809773-G-T 11689067-G-T **
13858454-G-C 11737748-G-C **
13865716-A-C 11745010-A-C **
13904643-G-T 11783937-G-T **
13943089-C-A 11822383-C-A **
14261715-A-G 12141009-A-G **
13958860-A-T 11838154-A-T **
13974075-G-C 11853369-G-C **
13975876-T-A 11855170-T-A **
13996685-T-A 11875979-T-A **
14007469-T-G 11886763-T-G **
14016151-G-T 11895445-G-T **
14041485-C-A 11920779-C-A **
14065405-A-C 11944699-A-C **
14065406-A-C 11944700-A-C **
14122811-G-A 12002105-G-A **
14154636-T-A 12033930-T-A **
14218741-G-C 12098035-G-C **
14226466-C-A 12105760-C-A **
18585716-C-A 16473836-C-A **
18769437-T-C 16657557-T-C **
18628212-G-A 16516332-G-A **
23953292-A-C 21807145-A-C **
23345704-C-T 21183818-C-T **
23395774-C-T 21233888-C-T **
23714763-G-A 21552877-G-A **
23714776-G-T 21552890-G-T **
23714791-T-A 21552905-T-A **
23714802-C-A 21552916-C-A **
23714813-C-A 21552927-C-A **
23714828-T-G 21552942-T-G **
23714836-C-T 21552950-C-T **
23779882-T-C 21617996-T-C **
21755294-G-T **
23953112-G-A 21806965-G-A **
24401984-A-G 22255837-A-G **
23315928-G-C 21154042-G-C **
24403341-T-G 22257194-T-G **
24424205-C-G 22278058-C-G **
24445491-C-G 22299344-C-G **
24588070-C-A 22441923-C-A P3_t2 **
24659328-G-T 22513181-G-T P3_b2 **
24875405-C-A 22729258-C-A g1 **
24880545-G-A 22734398-G-A g1 **
24880558-A-G 22734411-A-G g1 **
25520723-T-G 23374576-T-G P1_gr1 **
25646960-T-G 23500813-T-G P1_b3 **
25934845-T-C 23788698-T-C P1_Y1 **
25934850-A-G 23788703-A-G P1_Y1 **
25934859-G-C 23788712-G-C P1_Y1 **
23341109-G-T 21179223-G-T **
23127028-A-G 20965142-A-G **
25934879-C-G 23788732-C-G P1_Y1 **
22659479-A-T 20497593-A-T **
22023365-G-T 19861479-G-T **
22080905-C-A 19919019-C-A **
22085398-C-G 19923512-C-G **
22085407-C-G 19923521-C-G **
22085447-T-C 19923561-T-C **
22085487-C-T 19923601-C-T **
22153834-C-A 19991948-C-A **
22215281-G-A 20053395-G-A **
22624399-T-C 20462513-T-C **
22659453-T-A 20497567-T-A **
22659459-G-GA 20497573-G-GA **
22659464-CT-C 20497578-CT-C **
22690490-G-T 20528604-G-T **
23123138-T-C 20961252-T-C **
22774888-TTTCC-T 20613002-TTTCC-T **
22816199-A-C 20654313-A-C **
22901980-T-C 20740094-T-C **
22956130-T-G 20794244-T-G **
23007376-T-A 20845490-T-A **
23019802-A-G 20857916-A-G **
23019823-T-A 20857937-T-A **
23028130-C-G 20866244-C-G **
23056164-A-T 20894278-A-T **
23066420-C-A 20904534-C-A **
23099829-C-A 20937943-C-A **
23099845-A-G 20937959-A-G **
23120057-C-A 20958171-C-A **
25934871-A-T 23788724-A-T P1_Y1 **
25934882-G-C 23788735-G-C P1_Y1 **
21853652-C-A 19691766-C-A **
26157490-G-A 24011343-G-A P1_Y1 **
26157378-C-T 24011231-C-T P1_Y1 **
26157386-G-C 24011239-G-C P1_Y1 **
26157389-G-A 24011242-G-A P1_Y1 **
26157392-A-T 24011245-A-T P1_Y1 **
26157400-G-C 24011253-G-C P1_Y1 **
26157417-T-A 24011270-T-A P1_Y1 **
26157425-G-A 24011278-G-A P1_Y1 **
26157440-T-C 24011293-T-C P1_Y1 **
26157451-G-T 24011304-G-T P1_Y1 **
26157462-G-A 24011315-G-A P1_Y1 **
26157474-T-G 24011327-T-G P1_Y1 **
26157476-C-T 24011329-C-T P1_Y1 **
26201479-G-T 24055332-G-T P1_Y1 **
26157357-G-C 24011210-G-C P1_Y1 **
26262619-TA-T 24116472-TA-T P1_Y1 **
27861792-A-G 25715645-A-G P1_Y2 **
28076559-C-G 25930412-C-G P1_Y2 **
28482942-G-A 26336795-G-A **
28512275-C-A 26366128-C-A **
28518919-T-A 26372772-T-A **
28539867-G-T 26393720-G-T **
28614764-A-G 26468617-A-G **
28657094-C-A 26510947-C-A **
28791068-G-T 26644921-G-T **
28797915-A-C 26651768-A-C **
56685540-G-T **
56835897-T-C **
26157366-A-G 24011219-A-G P1_Y1 **
26043715-T-A 23897568-T-A P1_Y1 **
25934885-T-C 23788738-T-C P1_Y1 **
25981651-G-C 23835504-G-C P1_Y1 **
25934893-T-A 23788746-T-A P1_Y1 **
25934910-G-A 23788763-G-A P1_Y1 **
25934918-T-C 23788771-T-C P1_Y1 **
25934933-G-C 23788786-G-C P1_Y1 **
25934944-A-T 23788797-A-T P1_Y1 **
25934955-C-G 23788808-C-G P1_Y1 **
25934967-A-T 23788820-A-T P1_Y1 **
25934969-A-C 23788822-A-C P1_Y1 **
25934970-A-T 23788823-A-T P1_Y1 **
25934983-T-C 23788836-T-C P1_Y1 **
25981625-T-G 23835478-T-G P1_Y1 **
25981630-A-T 23835483-A-T P1_Y1 **
25981639-A-T 23835492-A-T P1_Y1 **
25981659-T-A 23835512-T-A P1_Y1 **
26043693-T-C 23897546-T-C P1_Y1 **
25981662-A-C 23835515-A-C P1_Y1 **
25981665-T-G 23835518-T-G P1_Y1 **
25981673-A-T 23835526-A-T P1_Y1 **
25981690-T-C 23835543-T-C P1_Y1 **
25981698-A-G 23835551-A-G P1_Y1 **
25981713-A-T 23835566-A-T P1_Y1 **
25981724-T-A 23835577-T-A P1_Y1 **
25981735-T-A 23835588-T-A P1_Y1 **
25981747-A-T 23835600-A-T P1_Y1 **
25981749-G-A 23835602-G-A P1_Y1 **
25981750-G-C 23835603-G-C P1_Y1 **
25981763-C-A 23835616-C-A P1_Y1 **
26026518-G-A 23880371-G-A P1_Y1 **
21954437-T-G 19792551-T-G **
21791268-G-T 19629382-G-T **
18636637-AT-A 16524757-AT-A **
19731814-C-A 17619934-C-A P5_Prx **
19731690-A-T 17619810-A-T P5_Prx **
19731704-T-G 17619824-T-G P5_Prx **
19731718-T-G 17619838-T-G P5_Prx **
19731729-G-T 17619849-G-T P5_Prx **
19731740-C-T 17619860-C-T P5_Prx **
19731755-T-G 17619875-T-G P5_Prx **
19731763-G-A 17619883-G-A P5_Prx **
19731780-C-G 17619900-C-G P5_Prx **
19731788-T-C 17619908-T-C P5_Prx **
19731791-C-G 17619911-C-G P5_Prx **
19731794-T-A 17619914-T-A P5_Prx **
19731802-C-A 17619922-C-A P5_Prx **
19731823-T-C 17619943-T-C P5_Prx **
19668744-A-G 17556864-A-G P5_Prx **
19739348-A-ACAC 17627468-A-ACAC P5_Prx **
19797876-A-T 17685996-A-T P5_Prx **
19797881-A-T 17686001-A-T P5_Prx **
19797890-C-T 17686010-C-T P5_Prx **
19797902-T-G 17686022-T-G P5_Prx **
19797910-C-T 17686030-C-T P5_Prx **
19797916-A-C 17686036-A-C P5_Prx **
19797924-A-C 17686044-A-C P5_Prx **
19797941-T-G 17686061-T-G P5_Prx **
19797949-G-T 17686069-G-T P5_Prx **
19797964-G-C 17686084-G-C P5_Prx **
19797975-T-C 17686095-T-C P5_Prx **
19797986-C-T 17686106-C-T P5_Prx **
19718023-A-T 17606143-A-T P5_Prx **
19668740-G-A 17556860-G-A P5_Prx **
19798014-G-T 17686134-G-T P5_Prx **
19155005-A-G 17043125-A-G **
18753033-G-A 16641153-G-A **
18753051-C-T 16641171-C-T **
10796688-A-ACTCGCGTTGG **
18846544-A-T 16734664-A-T **
18846548-C-A 16734668-C-A **
18864693-C-A 16752813-C-A **
18901241-C-A 16789361-C-A **
18925461-G-T 16813581-G-T **
18928612-G-T 16816732-G-T **
18949730-T-A 16837850-T-A **
19052435-A-AT 16940555-A-AT **
19071229-T-G 16959349-T-G **
19075019-C-T 16963139-C-T **
19187550-C-A 17075670-C-A **
19610397-C-G 17498517-C-G P5_Prx **
19187556-G-T 17075676-G-T **
19187572-C-G 17075692-C-G **
19187619-C-A 17075739-C-A **
19187621-C-G 17075741-C-G **
19187654-G-C 17075774-G-C **
19187668-T-A 17075788-T-A **
19204466-T-C 17092586-T-C **
19246022-C-T 17134142-C-T **
19246710-T-C 17134830-T-C **
19246734-T-C 17134854-T-C **
19505137-A-T 17393257-A-T **
19524625-A-G 17412745-A-G **
19524629-T-A 17412749-T-A **
19797998-C-G 17686118-C-G P5_Prx **
19816603-A-AC 17704723-A-AC P5_Prx **
21771550-C-T 19609664-C-T **
21281268-A-C 19119382-A-C **
20677530-G-C 18515644-G-C P4_Prx **
20677543-C-T 18515657-C-T P4_Prx **
20690215-C-A 18528329-C-A P4_Prx **
20728952-G-T 18567066-G-T P4_Prx **
20942953-A-AT 18781067-A-AT P4_Dst **
21023566-T-C 18861680-T-C P4_Dst **
21068295-C-A 18906409-C-A **
21087250-G-T 18925364-G-T **
21133439-T-G 18971553-T-G **
21281232-G-A 19119346-G-A **
21281243-C-A 19119357-C-A **
21281256-A-T 19119370-A-T **
21281336-T-A 19119450-T-A **
20677515-A-C 18515629-A-C P4_Prx **
21281350-G-A 19119464-G-A **
21318364-G-A 19156478-G-A **
21367417-C-G 19205531-C-G **
21380444-T-G 19218558-T-G **
21383457-G-A 19221571-G-A **
21438404-GA-G 19276518-GA-G **
21457337-C-A 19295451-C-A **
21544809-G-A 19382923-G-A **
21737822-T-G 19575936-T-G **
21737829-G-C 19575943-G-C **
21737833-T-A 19575947-T-A **
21737844-A-G 19575958-A-G **
21737847-T-A 19575961-T-A **
20677529-T-C 18515643-T-C P4_Prx **
20677504-T-C 18515618-T-C P4_Prx **
19816643-A-T 17704763-A-T P5_Prx **
20117024-C-G 18005144-C-G P5_Dst **
19816709-T-C 17704829-T-C P5_Prx **
19873896-G-T 17762016-G-T P5_Prx **
19873906-A-C 17762026-A-C P5_Prx **
19873910-T-A 17762030-T-A P5_Prx **
19873922-T-A 17762042-T-A P5_Prx **
19878234-A-C 17766354-A-C P5_Prx **
19878248-T-C 17766368-T-C P5_Prx **
19878250-T-A 17766370-T-A P5_Prx **
19878262-A-G 17766382-A-G P5_Prx **
19878273-A-G 17766393-A-G P5_Prx **
19878284-A-T 17766404-A-T P5_Prx **
20041972-T-C 17930092-T-C P5_Prx **
20117011-A-ACG 18005131-A-ACG P5_Dst **
20117057-A-T 18005177-A-T P5_Dst **
20677493-T-A 18515607-T-A P4_Prx **
20117122-G-A 18005242-G-A P5_Dst **
20142580-T-G 18030700-T-G P5_Dst **
20348055-T-TC 18186169-T-TC P5_Dst **
20348063-C-T 18186177-C-T P5_Dst **
20440390-A-G 18278504-A-G P5_Dst **
20538963-A-AG 18377077-A-AG P5_Dst **
20538995-A-G 18377109-A-G P5_Dst **
20539005-C-G 18377119-C-G P5_Dst **
20603820-AAGAG-A 18441934-AAGAG-A P5_Dst 10×AG**
20614944-C-G 18453058-C-G P4_Prx **
20677453-T-C 18515567-T-C P4_Prx **
20677470-C-A 18515584-C-A P4_Prx **
20677478-C-T 18515592-C-T P4_Prx **
10796700-T-A **
10787156-T-G **
10796686-C-CCCCTG **
17752034-A-G 15640154-A-G **
7311093-C-A 7443052-C-A **
2786002-A-C 2917961-A-C **
10771709-C-A **
22420389-T-G 20258503-T-G DYZ19 **
7164503-T-G 7296462-T-G **
17301231-C-A 15189351-C-A **
17511758-C-A 15399878-C-A **
11674905-C-A **
15171350-C-A 13059436-C-A **
20733589-C-A 18571703-C-A P4_Prx **
8344289-G-T 8476248-G-T **
17575533-C-A 15463653-C-A **
8661755-C-A 8793714-C-A **
7135386-A-AT 7267345-A-AT 22×T**
6730276-C-A 6862235-C-A **
18615959-TG-T 16504079-TG-T **
28588321-C-A 26442174-C-A **
28618275-A-C 26472128-A-C **
23425520-C-A 21263634-C-A **
17568460-C-A 15456580-C-A **
5621287-C-CGT 5753246-C-CGT **
7181894-C-A 7313853-C-A **
10653728-C-A **
13290997-G-A 11135321-G-A **
7183704-C-A 7315663-C-A **
19668783-A-AG 17556903-A-AG P5_Prx **
23372129-C-A 21210243-C-A **
10983609-T-G **
10958542-A-C **
10661716-TG-T **
10661721-T-C **
10661731-C-T **
17490974-C-A 15379094-C-A **
10987940-C-A **
4371124-C-A 4503083-C-A **
13487751-CCACA-C 11332075-CCACA-C **
5188687-C-A 5320646-C-A **
15733823-G-A 13621943-G-A **
10787143-C-A **
17402315-C-A 15290435-C-A **
11017482-C-A **
6523684-C-A 6655643-C-A **
21116829-C-A 18954943-C-A **
18159097-G-T 16047217-G-T **
11643696-A-ACAGAG **
28758039-C-A 26611892-C-A **
13939625-C-A 11818919-C-A **
21515860-CT-C 19353974-CT-C **
24301-T-G **
23421066-G-T 21259180-G-T **
19732411-T-TCA 17620531-T-TCA P5_Prx **
14245190-C-CA 12124484-C-CA 9×A**
10937470-C-T **
21153624-G-T 18991738-G-T **
10983602-T-A **
10828781-C-A **
10661714-C-A **
19668764-G-A 17556884-G-A P5_Prx **
7832159-CTTT-C 7964118-CTTT-C **
17376473-G-T 15264593-G-T **
8974532-G-T 9136923-G-T **
10851756-G-T **
13971568-AGAAG-A 11850862-AGAAG-A **
28580352-C-A 26434205-C-A **
3960930-C-A 4092889-C-A **
28533769-C-A 26387622-C-A **
13487766-CACA-C 11332090-CACA-C **
13487770-G-GTGT 11332094-G-GTGT **
19925895-A-AG 17814015-A-AG P5_Prx **
24381375-G-A 22235228-G-A **
14933545-C-A 12821610-C-A **
3275289-G-T 3407248-G-T **
7188225-C-A 7320184-C-A **
21240570-C-A 19078684-C-A **
7221768-C-A 7353727-C-A **
14701294-C-A 12589360-C-A **
28812343-G-A 26666196-G-A **
10999944-C-A **
13617546-C-A 11461870-C-A **
7203757-C-A 7335716-C-A **
10652123-A-C **
10937447-C-T **
10937471-A-ACTCAG **
10965461-C-A **
9938310-C-A 10100701-C-A **
20728991-TG-T 18567105-TG-T P4_Prx **
56861544-G-A **
7316601-C-A 7448560-C-A **
17289661-C-A 15177781-C-A **
13466386-T-C 11310710-T-C **
13466395-A-G 11310719-A-G **
19668732-T-A 17556852-T-A P5_Prx **
19187653-G-A 17075773-G-A **
10974739-A-C **
21802808-A-C 19640922-A-C **
18711418-C-A 16599538-C-A **
21902171-C-A 19740285-C-A **
8856525-C-A 8988484-C-A **
18554405-C-T 16442525-C-T **
13487739-T-TC 11332063-T-TC **
10647974-C-A **
23419200-C-A 21257314-C-A **
19154956-C-A 17043076-C-A **
3220812-C-A 3352771-C-A **
7832182-T-G 7964141-T-G **
7832187-TC-T 7964146-TC-T **
13249578-C-G 11093902-C-G **
14398427-C-A 12277723-C-A **
28808585-G-A 26662438-G-A **
5172332-C-A 5304291-C-A **
18094198-G-T 15982318-G-T **
6047269-C-A 6179228-C-A **
10661715-A-C **
8856379-C-A 8988338-C-A **
19668713-G-A 17556833-G-A P5_Prx **
11643687-T-TTGAAG **
10799489-C-A **
10937439-C-A **
6858618-G-T 6990577-G-T **
14176519-C-A 12055813-C-A **
18892327-C-A 16780447-C-A **
3284149-C-A 3416108-C-A **
6277749-A-C 6409708-A-C IR3_Dst **
23305771-C-A 21143885-C-A **
27585938-A-T 25439791-A-T P1_Y2 **
3374009-G-T 3505968-G-T **
15556692-C-A 13444812-C-A **
26043744-A-AT 23897597-A-AT P1_Y1 **
10937469-C-A **
20690179-T-TC 18528293-T-TC P4_Prx **
22210602-CA-C 20048716-CA-C **
6174485-G-T 6306444-G-T IR3_Dst **
10765743-T-A **
3688984-C-A 3820943-C-A **
6934842-C-A 7066801-C-A **
13447209-C-A 11291533-C-A **
28510974-C-A 26364827-C-A **
6277754-C-CCA 6409713-C-CCA IR3_Dst **
28510333-C-A 26364186-C-A **
10939755-T-C **
21220949-G-T 19059063-G-T **
19731703-C-G 17619823-C-G P5_Prx **
22081026-C-A 19919140-C-A **
17301238-C-A 15189358-C-A 23×A**
15323640-T-A 13211758-T-A FGC29270 **
28693905-A-G 26547758-A-G CTS12758 **
13466419-C-A 11310743-C-A **
13466451-A-T 11310775-A-T **
18873866-C-A 16761986-C-A ****
7832157-G-T 7964116-G-T **
7277048-G-GA 7409007-G-GA 12×A**
22167318-C-A 20005432-C-A **
14380229-C-A 12259525-C-A **
15928726-G-T 13816846-G-T **
16297287-C-A 14185407-C-A **
4890660-C-A 5022619-C-A 18×A**
27963547-ACT-A 25817400-ACT-A P1_Y2 8×CT**
26228719-G-A 24082572-G-A P1_Y1 **
22240757-C-A 20078871-C-A DYZ19 **
2865682-C-A 2997641-C-A **
18738177-C-A 16626297-C-A **
6977556-C-A 7109515-C-A **
7099910-C-A 7231869-C-A **
17992533-A-AC 15880653-A-AC P7_Prx **
10831642-C-A **
19187669-A-G 17075789-A-G **
16779213-C-A 14667333-C-A **
16629355-G-A 14517475-G-A F20905 **
18758950-CTTT-C 16647070-CTTT-C 13×T**
28808593-T-G 26662446-T-G **
10782829-C-A **
19558145-C-A 17446265-C-A **
19263511-T-A 17151631-T-A **
5267073-C-A 5399032-C-A **
18901098-C-A 16789218-C-A **
14754100-A-G 12642169-A-G **
10954328-C-A **
13421439-C-T 11265763-C-T **
23395723-T-C 21233837-T-C **
14823524-A-T 12711591-A-T **
6277760-G-A 6409719-G-A IR3_Dst **
21515858-G-A 19353972-G-A **
14443096-C-A 12322369-C-A **
19517280-C-A 17405400-C-A **
16653038-A-G 14541158-A-G **
21614749-C-A 19452863-C-A **
27872567-GA-G 25726420-GA-G P1_Y2 **
17284561-A-G 15172681-A-G **
21489197-A-C 19327311-A-C **
27585944-A-T 25439797-A-T P1_Y2 **
28461040-C-A 26314893-C-A **
13324708-C-A 11169032-C-A **
4769564-C-A 4901523-C-A **
28589485-C-A 26443338-C-A **
19187664-G-A 17075784-G-A **
16777908-C-A 14666028-C-A **
7115495-T-A 7247454-T-A A19080 **
21299203-C-A 19137317-C-A **
27872565-G-A 25726418-G-A P1_Y2 **
19187548-C-T 17075668-C-T **
15928735-G-T 13816855-G-T **
20434788-T-G 18272902-T-G P5_Dst **
10999885-A-C **
19187443-AC-A 17075563-AC-A **
26225010-T-TA 24078863-T-TA P1_Y1 **
13902177-C-A 11781471-C-A **
20326057-A-C 18164171-A-C P5_Dst **
7368877-C-A 7500836-C-A **
22659478-T-G 20497592-T-G **
3272720-C-A 3404679-C-A **
10851084-C-G **
10851086-A-G **
10851108-G-A **
11027383-T-C **
7269798-A-T 7401757-A-T **
10685441-C-A **
10958550-C-G **
13236366-C-A 11080690-C-A **
14398371-C-A 12277667-C-A **
4244891-C-A 4376850-C-A **
15770643-G-T 13658763-G-T **
9524231-CTA-C 9686622-CTA-C **
18045369-C-A 15933489-C-A **
19700819-T-G 17588939-T-G P5_Prx **
21771631-C-A 19609745-C-A **
10983584-C-T **
14550715-C-A 12438916-C-A **
9057571-G-T **
10971932-C-A **
14272833-C-A 12152127-C-A **
18901172-C-A 16789292-C-A **
7100670-C-A 7232629-C-A **
6998044-T-A 7130003-T-A **
6623199-T-G 6755158-T-G **
6626875-C-A 6758834-C-A **
6640979-T-A 6772938-T-A **
6640987-G-A 6772946-G-A **
6640998-T-A 6772957-T-A **
6641065-G-T 6773024-G-T **
6664010-G-T 6795969-G-T **
6694882-T-A 6826841-T-A **
6922649-T-G 7054608-T-G **
6925749-C-A 7057708-C-A **
6930549-A-T 7062508-A-T **
6996581-A-T 7128540-A-T **
7019249-T-A 7151208-T-A **
6505363-A-G 6637322-A-G **
7021064-C-A 7153023-C-A **
7030492-C-T 7162451-C-T **
7045665-T-A 7177624-T-A **
7063720-C-A 7195679-C-A **
7106440-T-G 7238399-T-G **
7111103-A-G 7243062-A-G **
7140353-G-A 7272312-G-A **
7163063-C-A 7295022-C-A **
7164518-G-T 7296477-G-T **
7180135-G-T 7312094-G-T **
7186732-A-G 7318691-A-G **
7188261-T-C 7320220-T-C **
6580576-C-T 6712535-C-T **
6477045-G-A 6609004-G-A **
7252380-A-G 7384339-A-G **
6132642-C-G 6264601-C-G **
6006610-C-T 6138569-C-T **
6006626-T-A 6138585-T-A **
6006637-A-T 6138596-A-T **
6006766-G-T 6138725-G-T **
6047247-T-G 6179206-T-G **
6132566-G-C 6264525-G-C **
6132583-A-T 6264542-A-T **
6132591-G-C 6264550-G-C **
6132606-G-C 6264565-G-C **
6132617-C-A 6264576-C-A **
6132628-G-T 6264587-G-T **
6132640-C-T 6264599-C-T **
56861637-G-T **
6456155-C-T 6588114-C-T **
6132656-C-T 6264615-C-T **
6183467-T-A 6315426-T-A IR3_Dst **
6183475-G-C 6315434-G-C IR3_Dst **
6183490-A-C 6315449-A-C IR3_Dst **
6183501-C-T 6315460-C-T IR3_Dst **
6183512-G-T 6315471-G-T IR3_Dst **
6183524-A-T 6315483-A-T IR3_Dst **
6183526-G-T 6315485-G-T IR3_Dst **
6183527-T-G 6315486-T-G IR3_Dst **
6183540-G-T 6315499-G-T IR3_Dst **
6359671-A-G 6491630-A-G **
6365127-G-T 6497086-G-T **
6455909-T-G 6587868-T-G **
7217423-G-C 7349382-G-C **
7292117-T-C 7424076-T-C **
5969722-G-T 6101681-G-T **
10667044-CATTCCATTCC-T **
8988656-A-T 9151047-A-T **
9778889-T-C 9941280-T-C **
9888920-G-T 10051311-G-T **
9938338-A-C 10100729-A-C **
9979001-C-A 10141392-C-A **
9999333-T-C 10161724-T-C **
10010487-C-A 10172878-C-A **
10045301-T-G 10207692-T-G **
10053765-C-A 10216156-C-A **
10054478-G-A 10216869-G-A **
10663050-A-G **
10666682-A-G **
10673817-C-G **
8985251-T-A 9147642-T-A **
10677306-T-A **
10678228-A-T **
10678267-C-G **
10749459-C-A **
10749480-T-A **
10769282-C-A **
10779648-G-C **
10779650-A-T **
10779658-G-T **
10779665-A-C **
10779670-A-T **
10780666-A-T **
8985394-T-C 9147785-T-C **
9057601-A-T **
7299794-A-T 7431753-A-T **
8075314-C-A 8207273-C-A **
7319626-C-A 7451585-C-A **
7322986-C-A 7454945-C-A **
7331318-C-A 7463277-C-A **
7342090-G-A 7474049-G-A **
7384722-C-A 7516681-C-A **
7434019-A-G 7565978-A-G **
7577240-G-T 7709199-G-T **
7579005-C-T 7710964-C-T **
7623558-C-T 7755517-C-T **
7702346-G-C 7834305-G-C **
7832196-CTT-C 7964155-CTT-C **
7990792-C-T 8122751-C-T **
8094470-CA-C 8226429-CA-C **
8856531-C-A 8988490-C-A **
8137345-A-G 8269304-A-G **
8216422-TG-T 8348381-TG-T **
8296968-T-A 8428927-T-A **
8314318-A-T 8446277-A-T **
8409214-A-G 8541173-A-G **
8671850-T-C 8803809-T-C **
8694326-A-G 8826285-A-G **
8697484-A-C 8829443-A-C **
8697503-A-C 8829462-A-C **
8761373-C-A 8893332-C-A **
8792963-C-G 8924922-C-G **
8807269-G-T 8939228-G-T **
8856389-C-A 8988348-C-A **
5990247-A-G 6122206-A-G **
6132643-T-A 6264602-T-A **
5897501-C-A 6029460-C-A **
3557335-C-T 3689294-C-T **
3057148-T-C 3189107-T-C **
3123853-C-A 3255812-C-A **
3187231-C-T 3319190-C-T **
3187270-C-T 3319229-C-T **
3187314-C-T 3319273-C-T **
3218465-C-T 3350424-C-T **
3218496-C-G 3350455-C-G **
3218594-G-C 3350553-G-C **
3334706-A-C 3466665-A-C **
3334707-A-C 3466666-A-C **
3386497-C-A 3518456-C-A **
3561679-G-T 3693638-G-T **
2956776-C-A 3088735-C-A **
3622277-T-C 3754236-T-C **
3708893-T-C 3840852-T-C **
3771221-C-G 3903180-C-G **
3771247-A-T 3903206-A-T **
3816093-G-T 3948052-G-T **
3850663-C-A 3982622-C-A **
3880387-A-C 4012346-A-C **
3987167-T-C 4119126-T-C **
4002964-A-T 4134923-A-T **
4002978-T-A 4134937-T-A **
4002989-C-T 4134948-C-T **
2980260-A-C 3112219-A-C **
2888868-CT-C 3020827-CT-C **
4054218-C-A 4186177-C-A **
13195855-C-A 11040179-C-A **
18325703-T-TG 16213823-T-TG P6_Prx **
3790666-C-A 3922625-C-A **
13460720-C-A 11305044-C-A **
11675657-C-G **
22775439-C-A 20613553-C-A **
7579991-G-A 7711950-G-A **
10921126-C-T **
10668443-C-A **
23623288-G-T 21461402-G-T **
22874532-C-A 20712646-C-A **
28024144-C-A 25877997-C-A P1_Y2 **
7325695-C-A 7457654-C-A **
2859104-T-A 2991063-T-A **
18427712-G-A 16315832-G-A P6_Dst **
3725778-C-A 3857737-C-A **
4582315-C-A 4714274-C-A **
18695893-T-C 16584013-T-C **
18926747-C-A 16814867-C-A **
19873998-T-TC 17762118-T-TC P5_Prx **
14218592-G-T 12097886-G-T **
2685706-G-C 2817665-G-C **
2693494-A-G 2825453-A-G **
2708127-T-A 2840086-T-A **
2758182-TG-T 2890141-TG-T **
2847251-C-A 2979210-C-A **
4049165-T-G 4181124-T-G **
3492699-T-A 3624658-T-A **
4082719-C-A 4214678-C-A **
5228245-C-A 5360204-C-A **
4672383-C-G 4804342-C-G **
4898022-A-G 5029981-A-G **
4898049-T-C 5030008-T-C **
4900177-G-C 5032136-G-C **
5056287-C-T 5188246-C-T **
5059577-T-A 5191536-T-A **
4091275-C-A 4223234-C-A **
5191440-G-A 5323399-G-A **
5202431-G-C 5334390-G-C **
5208807-C-A 5340766-C-A **
5226617-C-A 5358576-C-A **
5228276-T-C 5360235-T-C **
4460758-G-A 4592717-G-A **
5231111-T-G 5363070-T-G **
5266742-T-C 5398701-T-C **
5292155-G-A 5424114-G-A **
5361737-C-T 5493696-C-T **
5611998-T-G 5743957-T-G **
5612053-T-C 5744012-T-C **
5612151-A-G 5744110-A-G **
5612187-G-T 5744146-G-T **
5612212-T-A 5744171-T-A **
5626090-G-T 5758049-G-T **
5627782-T-A 5759741-T-A **
5739962-T-A 5871921-T-A **
4575564-C-A 4707523-C-A **
5191427-G-A 5323386-G-A **
4450208-C-A 4582167-C-A **
4108244-T-C 4240203-T-C **
4239058-A-C 4371017-A-C **
4371119-A-T 4503078-A-T **
4212709-C-T 4344668-C-T **
4168735-C-A 4300694-C-A **
4129137-T-G 4261096-T-G **
4371164-T-A 4503123-T-A **
4371144-T-A 4503103-T-A **
4438019-G-A 4569978-G-A **
4438041-T-G 4570000-T-G **
11671271-G-A ***
56833088-CTATATTTCAC-C,CTCTATTTCAT ***
10992904-C-A ***
20516562-A-T 18354676-A-T P5_Dst ***
7175997-C-A 7307956-C-A ***
13801124-G-GAAACC 11680418-G-GAAACC ***
21905310-T-C 19743424-T-C ***
17534671-G-T 15422791-G-T ***
22855260-G-T 20693374-G-T ***
28811761-G-C 26665614-G-C ***
13847184-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAGTGTAATGGAAAGATATCA 11726478-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAGTGTAATGGAAAGATATCA ***
13801149-G-A 11680443-G-A ***
10669609-G-A ***
17874199-C-A 15762319-C-A ***
13801139-G-A 11680433-G-A ***
23007638-G-T 20845752-G-T ***
21235226-T-A 19073340-T-A ***
56834459-A-ATTCCATTCCC ***
18059907-A-G 15948027-A-G ***
19539580-TTTA-T 17427700-TTTA-T ***
10674025-G-A,T ***
58975340-C-A 56829193-C-A ***
13461853-G-A 11306177-G-A ***
13940254-C-A 11819548-C-A ***
10033348-C-A 10195739-C-A ***
18754629-C-A 16642749-C-A ***
58980701-A-G 56834554-A-G ***
16564389-TAGAT-T,TAGAC 14452509-TAGAT-T,TAGAC ***
3148464-A-C 3280423-A-C ***
14364173-C-A 12243468-C-A ***
7783468-A-T 7915427-A-T ***
13811125-A-T 11690419-A-T ***
14219767-GA-G,GAA 12099061-GA-G,GAA 11×A***
14200637-C-A 12079931-C-A ***
13489483-C-A 11333807-C-A ***
13217600-C-A 11061924-C-A ***
19337663-A-G 17225783-A-G ***
18965642-CTTT-C 16853762-CTTT-C 19×T***
7148049-G-T 7280008-G-T ***
15747361-C-A 13635481-C-A ***
16825005-C-A 14713125-C-A ***
16467528-C-A 14355648-C-A A15579 ***
22634002-A-G 20472116-A-G ***
19338204-C-A 17226324-C-A ***
8827328-C-A 8959287-C-A ***
13461099-G-C 11305423-G-C ***
17375967-G-T 15264087-G-T ***
16467553-C-A 14355673-C-A ***
4325776-G-C 4457735-G-C ***
7188529-C-A 7320488-C-A ***
13801111-A-T 11680405-A-T ***
8428933-A-C 8560892-A-C ***
13801133-G-T 11680427-G-T ***
28766437-CAAA-C 26620290-CAAA-C 17×A***
11676851-G-T ***
22103540-C-A 19941654-C-A ***
58983148-C-T 56837001-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 6396111064868776985587778351
Kit: 639611963267478438487734184
Used in age calculations1064868778438487778351
Counts of SNPs65
Variant counts last updated 2019-03-05 01:03:12.



Big Tree Main Page