Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > ZZ44 > A9871 > BY20951 > BY20954 > FGC65820

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
38962
BigY3
38962
BigY2
38962
19586695-A-AT 17474815-A-AT P5_Prx 22×TA*
14971076-C-CT 12859151-C-CT 13×TA*
56834183-C-T A*
14265316-G-C 12144610-G-C FGC65822 YY+++
11015325-A-T +
4815282-G-C 4947241-G-C FT86008 +
6019240-A-C 6151199-A-C *
4189326-G-A 4321285-G-A *
4249244-G-A 4381203-G-A FGC40365 *
6019209-G-A 6151168-G-A *
10760684-TTTCCATTCCA-T ***
10898323-C-A **
14472848-G-T 12352117-G-T **
14451287-C-A 12330560-C-A **
14464397-G-A 12343670-G-A **
14463600-T-G 12342873-T-G **
14502419-A-G 12390624-A-G **
14392921-A-T 12272217-A-T **
14385782-G-T 12265078-G-T **
14367837-A-G 12247133-A-G **
12379348-C-A **
14549497-G-T 12437698-G-T **
14521689-C-A 12409890-C-A **
14527586-A-T 12415787-A-T **
14347877-C-A 12227172-C-A **
14558461-C-T 12446662-C-T **
14563573-C-A 12451773-C-A **
14568976-A-G 12457176-A-G **
14590608-T-TA 12478808-T-TA 9×A**
14717505-G-T 12605573-G-T **
14743657-C-A 12631726-C-A **
14757876-T-C 12645945-T-C **
14780946-C-A 12669016-C-A **
14784723-TGA-T 12672793-TGA-T **
14824823-C-A 12712890-C-A **
14858653-G-T 12746719-G-T **
14858704-G-T 12746770-G-T **
14357835-C-A 12237130-C-A **
14267064-C-A 12146358-C-A **
14297835-G-A 12177129-G-A **
14021345-G-T 11900639-G-T **
13855555-G-A 11734849-G-A **
13870717-C-A 11750011-C-A **
13896296-G-T 11775590-G-T **
13909892-C-A 11789186-C-A **
13926581-G-T 11805875-G-T **
13928185-G-A 11807479-G-A **
13928816-C-A 11808110-C-A **
13937472-C-A 11816766-C-A **
13938836-C-A 11818130-C-A **
13940623-G-A 11819917-G-A **
13942424-A-T 11821718-A-T **
14021338-C-T 11900632-C-T **
14025444-C-A 11904738-C-A **
14286916-A-C 12166210-A-C **
14041596-C-A 11920890-C-A **
14079589-T-C 11958883-T-C **
14086103-G-A 11965397-G-A **
14099782-C-A 11979076-C-A **
14107700-C-A 11986994-C-A **
14146966-TTA-T 12026260-TTA-T **
14159655-C-A 12038949-C-A **
14159773-G-T 12039067-G-T **
14204888-G-T 12084182-G-T **
14252207-C-A 12131501-C-A **
14910787-G-T 12798854-G-T **
14281100-C-A 12160394-C-A **
14281105-AC-A 12160399-AC-A **
14871396-C-T 12759466-C-T **
14992830-G-A 12880915-G-A **
14926263-A-C 12814328-A-C **
16421605-G-C 14309725-G-C **
15909297-A-T 13797417-A-T **
15911541-C-A 13799661-C-A **
15932166-A-G 13820286-A-G **
15988056-T-C 13876176-T-C **
15988136-A-G 13876256-A-G **
16004170-G-T 13892290-G-T **
16029718-T-G 13917838-T-G **
16039224-C-A 13927344-C-A **
16044820-G-A 13932940-G-A **
16066721-A-C 13954841-A-C **
16101996-C-CTT 13990116-C-CTT P8_Prx 19×T**
16216713-C-A 14104833-C-A **
16424184-A-T 14312304-A-T **
15781775-A-C 13669895-A-C **
16478225-T-G 14366345-T-G **
16478228-T-A 14366348-T-A **
16526632-T-A 14414752-T-A **
16583427-C-A 14471547-C-A **
16598999-A-G 14487119-A-G **
16617551-T-G 14505671-T-G **
16617588-T-G 14505708-T-G **
16617633-C-A 14505753-C-A **
16620621-A-C 14508741-A-C **
16620685-A-G 14508805-A-G **
16739407-C-A 14627527-C-A **
16745164-A-C 14633284-A-C **
15823757-C-A 13711877-C-A **
15773556-C-A 13661676-C-A **
14938622-T-A 12826697-T-A **
15264775-C-T 13152864-C-T **
14992709-G-T 12880794-G-T **
14992829-T-C 12880914-T-C **
13855544-TG-T 11734838-TG-T **
14992950-C-A 12881035-C-A **
15044675-G-T 12932765-G-T **
15080637-C-A 12968727-C-A **
15102532-G-T 12990620-G-T **
15132079-TG-A 13020166-TG-A **
15132115-T-G 13020202-T-G **
15150825-C-A 13038912-C-A **
15171493-G-C 13059579-G-C **
15264760-C-T 13152849-C-T **
15288708-C-A 13176807-C-A **
15753175-T-TAG 13641295-T-TAG **
15302791-C-T 13190890-C-T **
15333700-C-A 13221818-C-A **
15334510-C-A 13222628-C-A **
15352811-C-A 13240930-C-A **
15410795-C-A 13298915-C-A **
15442453-A-C 13330573-A-C **
15542034-A-G 13430154-A-G **
15596093-G-T 13484213-G-T **
15619532-GA-G 13507652-GA-G 9×A**
15623511-C-A 13511631-C-A **
15653310-A-C 13541430-A-C **
15740754-C-A 13628874-C-A **
15742100-C-G 13630220-C-G **
13855548-A-AT 11734842-A-AT **
11670330-G-A **
13855538-A-C 11734832-A-C **
10912610-C-A **
10887890-C-A **
10895905-C-A **
10900489-C-A **
10900552-G-C **
10900739-C-A **
10902059-C-A **
10904612-A-C **
10906414-C-A **
10910889-T-C **
10910890-A-G **
10910892-A-G **
10910906-G-T **
10918110-G-T **
10884127-C-A **
10921283-A-C **
10926237-A-G **
10926271-C-G **
10926782-C-A **
10931868-C-A **
10935366-G-C **
10935386-G-C **
10935404-C-A **
10938673-C-CCATTT **
10938691-ATTTTC-A **
10938719-C-A **
10940326-C-T **
10884986-G-A **
10879374-C-A **
10946871-C-A **
10870909-C-A **
10868043-C-G **
10868050-CG-C **
10870439-C-G **
10870458-A-G **
10870459-T-C **
10870461-T-G **
10870463-ACCCAG-A **
10870487-C-T **
10870494-T-C **
10870506-C-G **
10870519-T-A **
10870524-T-C **
10876521-C-A **
10879373-C-G **
10879305-G-T **
10879311-T-A **
10879323-C-A **
10879325-C-T FT56498 **
10879325-C-CTCCTT **
10879337-C-A **
10879338-T-A **
10879356-C-T **
10879362-A-T **
10879363-A-G **
10879364-G-A **
10879368-C-G **
10940542-A-C **
10947804-T-G **
13855385-T-C 11734679-T-C **
13248491-C-A 11092815-C-A **
11020632-A-T **
11020642-A-T **
11020651-C-A **
11021432-C-T **
11022140-C-T **
11026219-C-G **
11031712-A-C **
11037740-C-A **
11037896-T-C **
13209561-T-G 11053885-T-G **
13213988-A-G 11058312-A-G **
13234424-C-A 11078748-C-A **
13402609-T-C 11246933-T-C **
11020621-C-G **
13461036-T-C 11305360-T-C **
13496745-G-T 11341069-G-T **
13583807-T-A 11428131-T-A **
13631270-C-A 11475594-C-A **
13643164-T-A 11487488-T-A **
11653455-T-A **
11656260-A-G **
11668748-C-A **
16863793-C-T 14751913-C-T **
11675031-G-T **
11675045-A-G **
13847051-A-G 11726345-A-G **
11020622-T-G **
11020619-C-G **
10949468-C-T **
10990060-C-A **
10951859-C-A **
10959211-C-A **
10959348-C-A **
10969228-T-C **
10969235-T-G **
10969249-T-A **
10969267-A-G **
10972036-G-C **
10973674-A-C **
10979687-G-T **
10980783-CCACTA-C **
10985452-T-C **
10997020-C-A **
11020583-T-C **
11000054-G-C **
11000407-C-G **
11005676-T-G **
11010127-T-C **
11010626-C-A **
11011470-T-A **
11011486-T-A **
11011718-A-G **
11016576-T-C **
11020087-A-T **
11020569-C-T **
11020578-C-T **
16863691-C-A 14751811-C-A **
17029145-A-G 14917265-A-G **
16865134-T-C 14753254-T-C **
23333777-T-C 21171891-T-C **
22845958-A-C 20684072-A-C **
22857805-A-G 20695919-A-G **
22869711-C-A 20707825-C-A **
22874550-C-A 20712664-C-A **
22893273-G-A 20731387-G-A **
22965684-C-A 20803798-C-A **
22993384-A-T 20831498-A-T **
23039482-C-A 20877596-C-A **
23096690-G-T 20934804-G-T **
23144263-C-A 20982377-C-A **
23197939-G-T 21036053-G-T **
23310582-G-A 21148696-G-A **
23419656-CT-C 21257770-CT-C **
22843767-C-A 20681881-C-A **
23421082-C-T 21259196-C-T **
23421086-C-A 21259200-C-A **
23516464-A-C 21354578-A-C **
23838859-G-T 21676973-G-T **
23838861-C-G 21676975-C-G **
24252250-A-AC 22106103-A-AC P3_b1 **
24363970-T-C 22217823-T-C **
24381424-G-T 22235277-G-T **
24407178-G-T 22261031-G-T **
24475308-T-A 22329161-T-A **
24751517-G-T 22605370-G-T P3_b2 **
24875428-A-C 22729281-A-C g1 **
22843779-A-G 20681893-A-G **
22842207-C-A 20680321-C-A **
24904717-C-T 22758570-C-T g1 **
22067617-C-A 19905731-C-A **
21714670-A-G 19552784-A-G **
21714674-A-G 19552788-A-G **
21714681-G-A 19552795-G-A **
21714685-C-G 19552799-C-G **
21771571-T-G 19609685-T-G **
21953574-C-T 19791688-C-T **
21990378-A-C 19828492-A-C **
21990385-C-A 19828499-C-A **
21990390-A-C 19828504-A-C **
21990398-A-C 19828512-A-C **
21994045-C-A 19832159-C-A **
22065372-C-A 19903486-C-A **
22123004-C-A 19961118-C-A **
22816182-A-G 20654296-A-G **
22124117-T-G 19962231-T-G **
22214821-G-T 20052935-G-T **
22214842-G-C 20052956-G-C **
22252477-G-A 20090591-G-A DYZ19 **
22489650-C-A 20327764-C-A DYZ19 **
22526395-C-A 20364509-C-A **
22535852-C-A 20373966-C-A **
22535920-T-A 20374034-T-A **
22588006-C-A 20426120-C-A **
22588018-C-A 20426132-C-A **
22619509-T-C 20457623-T-C **
22713956-G-T 20552070-G-T **
24878892-G-T 22732745-G-T g1 **
25995429-T-G 23849282-T-G P1_Y1 **
21714663-G-C 19552777-G-C **
56830180-C-T **
28656782-C-A 26510635-C-A **
28745064-C-T 26598917-C-T **
28747697-C-G 26601550-C-G **
28747701-C-G 26601554-C-G **
28747773-G-C 26601626-G-C **
28756226-C-A 26610079-C-A **
28760171-C-A 26614024-C-A **
28763478-C-A 26617331-C-A Z29906 **
28772890-C-A 26626743-C-A **
28779741-G-T 26633594-G-T **
28797925-A-C 26651778-A-C **
28798109-A-C 26651962-A-C **
56830190-C-G **
28641162-C-A 26495015-C-A **
56830184-CTTCCACTCCTCTCCACCACA-C **
56846277-C-G **
56848908-A-C **
33952-G-C **
7414277-CAAAA-C 7546236-CAAAA-C 27×A**
13467120-C-A 11311444-C-A **
3459813-A-G 3591772-A-G **
9524136-C-T 9686527-C-T **
13932160-TA-T 11811454-TA-T **
14690627-G-A 12578693-G-A **
19102770-A-G 16990890-A-G **
21806963-T-C 19645077-T-C **
28644386-T-A 26498239-T-A **
28632836-C-A 26486689-C-A **
25995545-A-AGT 23849398-A-AGT P1_Y1 **
27447555-T-G 25301408-T-G P1_Y2 **
26073703-A-G 23927556-A-G P1_Y1 **
26073834-T-A 23927687-T-A P1_Y1 **
26201734-A-G 24055587-A-G P1_Y1 **
26249039-C-A 24102892-C-A P1_Y1 5×AAAT**
26386151-A-C 24240004-A-C P1_Y1 **
26386473-T-C 24240326-T-C P1_Y1 **
26707485-G-T 24561338-G-T P1_g2 **
27240347-T-C 25094200-T-C P1_g3 **
27417732-T-A 25271585-T-A P1_g3 **
27417740-C-T 25271593-C-T P1_g3 **
27417746-T-G 25271599-T-G P1_g3 **
27447483-T-TGG 25301336-T-TGG P1_Y2 **
27461999-C-A 25315852-C-A P1_Y2 **
28620676-G-A 26474529-G-A **
27822424-C-A 25676277-C-A P1_Y2 **
27872825-C-T 25726678-C-T P1_Y2 **
27967296-T-A 25821149-T-A P1_Y2 **
28470596-CTCTA-C 26324449-CTCTA-C **
28496444-A-G 26350297-A-G **
28496450-G-A 26350303-G-A **
28505325-C-A 26359178-C-A **
28507562-G-T 26361415-G-T Y113099 **
28529658-T-A 26383511-T-A **
28532174-C-A 26386027-C-A **
28570107-T-C 26423960-T-C **
28594312-A-C 26448165-A-C **
21714666-G-T 19552780-G-T **
21677572-C-T 19515686-C-T **
16897630-C-A 14785750-C-A **
18337336-C-T 16225456-C-T P6_Prx **
18059920-T-G 15948040-T-G **
18085461-T-C 15973581-T-C **
18085498-C-A 15973618-C-A **
18085645-T-G 15973765-T-G **
18138085-C-A 16026205-C-A **
18159176-C-G 16047296-C-G **
18159246-A-T 16047366-A-T **
18159763-G-T 16047883-G-T **
18188703-T-G 16076823-T-G **
18189681-C-T 16077801-C-T **
18190594-A-T 16078714-A-T **
18190688-G-T 16078808-G-T **
18381814-C-A 16269934-C-A P6_Gap **
17994797-T-A 15882917-T-A P7_Prx **
18412352-C-A 16300472-C-A P6_Gap **
18443607-G-T 16331727-G-T P6_Dst **
18480326-A-G 16368446-A-G P6_Dst **
18531061-C-G 16419181-C-G P6_Dst **
18646044-G-T 16534164-G-T **
18682749-C-T 16570869-C-T **
18687600-G-T 16575720-G-T **
18730812-C-A 16618932-C-A **
18738270-A-G 16626390-A-G **
18748854-G-A 16636974-G-A **
18792685-C-A 16680805-C-A **
18795038-A-T 16683158-A-T **
18008687-T-G 15896807-T-G P7_Dst **
17918695-C-A 15806815-C-A **
18795098-G-T 16683218-G-T **
17480226-C-A 15368346-C-A **
16897635-C-A 14785755-C-A **
16922216-C-A 14810336-C-A **
16969380-C-T 14857500-C-T Y70823 **
10850924-G-T **
17130055-T-C 15018175-T-C **
17158993-T-C 15047113-T-C **
17206612-T-C 15094732-T-C **
17238457-T-C 15126577-T-C **
17346129-T-G 15234249-T-G **
17378950-G-T 15267070-G-T **
17379013-G-C 15267133-G-C **
17385484-C-A 15273604-C-A **
17482973-G-T 15371093-G-T **
17916640-A-G 15804760-A-G **
17527327-C-A 15415447-C-A 8×AT**
17546040-C-A 15434160-C-A **
17668441-C-A 15556561-C-A **
17684454-A-G 15572574-A-G **
17728653-T-C 15616773-T-C **
17737919-C-A 15626039-C-A **
17752064-C-T 15640184-C-T **
17812187-G-C 15700307-G-C **
17864838-C-A 15752958-C-A **
17864954-C-A 15753074-C-A **
17865861-T-C 15753981-T-C **
17886486-C-A 15774606-C-A **
18795041-C-A 16683161-C-A **
18795127-C-T 16683247-C-T **
21597026-G-A 19435140-G-A **
21238714-C-A 19076828-C-A **
20693703-G-T 18531817-G-T P4_Prx **
20751889-T-G 18590003-T-G P4_Prx **
20789761-C-T 18627875-C-T P4_Prx **
20789780-A-C 18627894-A-C P4_Prx **
20809731-A-G 18647845-A-G P4_Gap **
20839531-C-A 18677645-C-A P4_Gap **
21068302-T-C 18906416-T-C **
21106919-A-C 18945033-A-C **
21152250-G-T 18990364-G-T **
21185088-T-G 19023202-T-G **
21201286-C-T 19039400-C-T **
21211407-G-T 19049521-G-T **
21371602-C-A 19209716-C-A **
20408916-A-G 18247030-A-G P5_Dst **
21394871-G-T 19232985-G-T **
21438152-C-T 19276266-C-T **
21438160-T-C 19276274-T-C **
21442887-G-C 19281001-G-C **
21477047-A-C 19315161-A-C **
21477082-T-G 19315196-T-G **
21477083-G-T 19315197-G-T **
21482853-C-A 19320967-C-A **
21505560-C-T 19343674-C-T A17622 **
21524863-C-G 19362977-C-G **
21524864-C-A 19362978-C-A **
21583999-C-G 19422113-C-G **
20603814-GAAAGAA-G 18441928-GAAAGAA-G P5_Dst **
20137456-A-T 18025576-A-T P5_Dst **
18859215-A-C 16747335-A-C **
19303870-G-T 17191990-G-T **
18859229-C-A 16747349-C-A **
19030196-C-A 16918316-C-A **
19044398-C-A 16932518-C-A **
19052065-C-A 16940185-C-A **
19052437-A-T 16940557-A-T **
19066040-C-A 16954160-C-A **
19071814-C-G 16959934-C-G **
19086104-G-A 16974224-G-A **
19086115-G-C 16974235-G-C **
19112325-C-A 17000445-C-A **
19112410-T-C 17000530-T-C **
19300293-C-A 17188413-C-A **
19304269-C-A 17192389-C-A **
20084145-AG-A 17972265-AG-A P5_Dst **
19373797-A-C 17261917-A-C **
19403996-C-A 17292116-C-A **
19413338-A-G 17301458-A-G **
19472523-G-T 17360643-G-T **
19512724-C-A 17400844-C-A **
19515159-A-G 17403279-A-G **
19524446-T-C 17412566-T-C **
19547638-A-G 17435758-A-G **
19563104-T-G 17451224-T-G **
19563114-C-A 17451234-C-A **
19563126-C-T 17451246-C-T **
19563185-A-T 17451305-A-T **
19979864-C-CTA 17867984-C-CTA P5_Prx 28×T**
10868031-A-AT **
17812185-C-A 15700305-C-A **
10846510-C-A **
8314175-C-G 8446134-C-G **
18223906-C-A 16112026-C-A **
10671008-T-TTGCAC **
10671015-C-CCGTTA **
10671020-C-CCACCA **
10671027-A-T **
10671038-T-A **
16506766-C-CAA 14394886-C-CAA 19×A**
6784531-T-G 6916490-T-G **
23438861-T-G 21276975-T-G **
28095982-A-C 25949835-A-C P1_Y2 **
6784516-A-C 6916475-A-C **
19531440-C-A 17419560-C-A **
6784518-G-T 6916477-G-T **
6784532-C-T 6916491-C-T FT78729 **
4382449-C-A 4514408-C-A 17×A**
2701364-T-G 2833323-T-G **
2718915-C-G 2850874-C-G **
2729811-A-G 2861770-A-G **
2788181-C-G 2920140-C-G **
2810390-G-TT 2942349-G-TT **
2810467-A-T 2942426-A-T **
2810468-G-T 2942427-G-T **
10940026-T-C **
17934129-C-A 15822249-C-A **
2859645-C-A 2991604-C-A **
2859124-C-A 2991083-C-A **
28594317-C-A 26448170-C-A FT44572 **
6645492-C-A 6777451-C-A **
10870433-A-C **
10870448-A-C **
10870454-T-C **
16969391-C-T 14857511-C-T **
13486852-A-G 11331176-A-G **
13486855-C-A 11331179-C-A **
10868041-C-T **
17151445-C-A 15039565-C-A **
15495460-C-A 13383580-C-A 16×A**
21935141-C-A 19773255-C-A **
22768227-C-A 20606341-C-A **
11022606-C-A **
15132089-G-C 13020176-G-C **
6040234-C-A 6172193-C-A **
8281801-G-A 8413760-G-A **
7054275-C-A 7186234-C-A **
18789747-C-A 16677867-C-A **
6948246-A-T 7080205-A-T **
20793539-A-AC 18631653-A-AC P4_Prx **
9941574-C-A 10103965-C-A **
10845997-A-C **
2947818-C-A 3079777-C-A **
10759876-A-T **
4444845-A-C 4576804-A-C **
4136905-A-C 4268864-A-C **
4215500-G-T 4347459-G-T **
4244689-C-A 4376648-C-A **
4262418-C-A 4394377-C-A **
4271129-C-A 4403088-C-A **
4301890-C-A 4433849-C-A **
4346254-G-T 4478213-G-T **
4357414-G-C 4489373-G-C **
4357917-T-C 4489876-T-C **
4382448-T-C 4514407-T-C **
4447595-C-A 4579554-C-A **
4095257-A-G 4227216-A-G **
4447619-G-C 4579578-G-C **
4470455-A-G 4602414-A-G **
4494078-G-T 4626037-G-T **
4505203-C-A 4637162-C-A **
4511120-C-A 4643079-C-A **
4521602-A-C 4653561-A-C **
4557253-A-G 4689212-A-G **
4602551-G-T 4734510-G-T **
4740467-G-T 4872426-G-T **
4770501-T-A 4902460-T-A **
4095330-C-A 4227289-C-A **
4095238-A-G 4227197-A-G **
2960055-C-T 3092014-C-T **
3563473-T-C 3695432-T-C **
2980356-T-G 3112315-T-G **
3005334-C-G 3137293-C-G **
3016290-C-A 3148249-C-A **
3048054-C-A 3180013-C-A **
3057650-A-T 3189609-A-T **
3061188-C-A 3193147-C-A **
3164779-G-T 3296738-G-T **
3272854-C-A 3404813-C-A **
3361934-C-A 3493893-C-A **
3536208-C-A 3668167-C-A **
3610170-C-T 3742129-C-T **
4093314-T-C 4225273-T-C **
3626282-C-A 3758241-C-A **
3680869-G-T 3812828-G-T **
3759181-C-A 3891140-C-A **
3812481-G-T 3944440-G-T **
3830992-G-A 3962951-G-A **
3849318-C-A 3981277-C-A **
3922720-C-A 4054679-C-A **
4003103-G-A 4135062-G-A **
4063735-G-T 4195694-G-T **
4093295-C-G 4225254-C-G **
10759879-ACACTGCACCG-A **
10759842-T-TTACAC **
4863524-A-C 4995483-A-C **
16897633-G-A 14785753-G-A **
16279170-C-A 14167290-C-A **
13932166-TA-T 11811460-TA-T **
4908014-TA-T 5039973-TA-T 9×A**
10759829-C-T **
19109973-C-A 16998093-C-A **
11000076-G-T **
20404445-CAAA-C 18242559-CAAA-C P5_Dst 29×A**
14009380-A-T 11888674-A-T **
10792578-C-A **
28484913-C-A 26338766-C-A **
10862364-C-A **
20332015-T-A 18170129-T-A P5_Dst **
2778577-C-A 2910536-C-A **
22237694-A-T 20075808-A-T DYZ19 **
10870501-A-C **
10870507-G-C **
8124979-T-A 8256938-T-A **
18154451-C-A 16042571-C-A **
28763374-C-A 26617227-C-A **
11004422-T-C **
10978606-C-A **
10796699-T-C **
14786328-C-A 12674398-C-A **
28621268-G-T 26475121-G-T **
25990670-C-T 23844523-C-T P1_Y1 **
13697980-C-A 11542304-C-A **
58976325-T-C 56830178-T-C **
58833966-TCCATTCCATA-T 56756885-GATGGAATGGT-G **
4382439-G-A 4514398-G-A **
27417747-G-A 25271600-G-A P1_g3 **
20815462-T-TAC 18653576-T-TAC P4_Gap 12×AC**
25990675-A-C 23844528-A-C P1_Y1 **
16188181-C-T 14076301-C-T 16×T**
18454858-C-T 16342978-C-T P6_Dst 5×CTTT**
18906391-GTAA-G 16794511-GTAA-G 6×TAA**
28747685-A-T 26601538-A-T **
13322496-T-A 11166820-T-A **
15333826-A-G 13221944-A-G YSC0000725 ****
16703826-G-T 14591946-G-T **
20326055-G-A 18164169-G-A P5_Dst **
59008408-C-T 56862261-C-T **
23380570-C-A 21218684-C-A 13×A**
17994798-G-A 15882918-G-A P7_Prx **
3663312-C-T 3795271-C-T **
22325184-T-A 20163298-T-A DYZ19 **
13467113-C-A 11311437-C-A **
13463950-C-A 11308274-C-A **
22427550-T-G 20265664-T-G DYZ19 **
25990666-C-T 23844519-C-T P1_Y1 **
25995544-G-A 23849397-G-A P1_Y1 **
28464018-C-A 26317871-C-A **
10796696-C-G **
10845691-C-A **
10759865-C-A FT92629 **
10926241-C-G **
10926243-A-T **
10926245-C-T **
10926253-T-C **
10926258-A-C **
10926268-C-T **
10926281-A-C **
10796661-C-CTACAA **
11026015-T-C **
15449928-C-T 13338048-C-T **
23476305-T-TA 21314419-T-TA 10×A**
10969257-A-T **
17538046-C-A 15426166-C-A **
10868002-T-A **
10949437-G-C **
19146543-C-A 17034663-C-A **
25617227-C-A 23471080-C-A P1_gr1 **
9307450-G-T 9469841-G-T **
24904721-T-A 22758574-T-A g1 **
56830233-C-T **
10766642-C-A **
22214838-C-A 20052952-C-A **
9310614-G-A 9473005-G-A **
16897641-C-T 14785761-C-T **
15449920-C-A 13338040-C-A **
10755484-C-T **
2810465-A-T 2942424-A-T **
9307440-A-T 9469831-A-T **
16188176-C-T 14076296-C-T **
10961529-C-T **
13884908-C-A 11764202-C-A **
17874234-C-A 15762354-C-A **
22876436-C-A 20714550-C-A **
18480357-T-A 16368477-T-A P6_Dst **
21905324-T-C 19743438-T-C **
10961521-A-C **
15495451-G-A 13383571-G-A **
10841121-G-C **
10969266-C-A **
21187394-C-A 19025508-C-A **
18930531-C-A 16818651-C-A **
10671039-T-A **
21639007-C-A 19477121-C-A **
24080106-C-A 21933959-C-A P3_b1 **
7214515-C-A 7346474-C-A A17619 **
11004430-C-G **
4863239-G-T 4995198-G-T **
2810470-G-T 2942429-G-T **
4863614-A-C 4995573-A-C **
8970811-G-T 9133202-G-T **
8290914-C-A 8422873-C-A **
8314172-A-G 8446131-A-G **
8314189-G-T 8446148-G-T **
8379496-C-A 8511455-C-A **
8389596-A-G 8521555-A-G **
8661305-C-A 8793264-C-A **
8713655-A-C 8845614-A-C **
8816942-G-A 8948901-G-A **
8908044-T-G 9040003-T-G **
9056862-C-A **
10839026-A-T **
8235488-G-T 8367447-G-T **
10839019-C-A **
8982993-G-T 9145384-G-T **
9063740-C-A 9226131-C-A **
9211561-A-G 9373952-A-G **
9305838-T-A 9468229-T-A **
9373009-G-T 9535400-G-T **
9379035-T-A 9541426-T-A **
9465233-C-T 9627624-C-T **
9513296-T-G 9675687-T-G **
4871961-T-A 5003920-T-A **
8281811-G-A 8413770-G-A **
8073976-C-A 8205935-C-A **
9524287-G-C 9686678-G-C **
10839045-C-T **
10839052-T-A **
7310621-T-G 7442580-T-G **
7337102-C-A 7469061-C-A **
7363686-C-A 7495645-C-A **
7363889-C-A 7495848-C-A **
7374336-C-A 7506295-C-A **
7416680-A-C 7548639-A-C **
10794427-T-C **
7443929-C-A 7575888-C-A **
7443953-C-A 7575912-C-A **
7475144-G-T 7607103-G-T IR1_L **
10839029-C-T **
7536392-C-A 7668351-C-A **
7613818-C-A 7745777-C-A **
7615172-T-G 7747131-T-G **
7711938-G-T 7843897-G-T **
10839030-C-CT **
7754305-G-T 7886264-G-T **
7970344-A-C 8102303-A-C **
7990688-C-A 8122647-C-A A18594 **
8043293-T-G 8175252-T-G FT4829 **
8043294-A-T 8175253-A-T FT4830 **
9521276-T-C 9683667-T-C **
9524289-C-A 9686680-C-A 8×TA**
7269931-T-A 7401890-T-A **
10771681-C-A **
10748478-CTCCAT-C **
10759766-C-CCTTCT **
10759794-C-A **
10759782-CTCCAT-C **
10759820-C-A **
10762593-C-A **
10762611-C-A **
10765420-C-A **
10771016-C-A **
10810981-C-A **
10810628-C-A **
10744555-A-C **
10777611-C-A **
10782003-C-A **
10782026-C-A **
10788667-C-A **
10789264-T-C **
10793317-G-T **
10800378-T-A **
10796223-GT-G **
10793419-T-C **
10796223-G-C **
10811002-C-T **
10692601-C-A **
9590560-T-TC 9752951-T-TC IR3_Prx **
10618163-T-A **
9590603-G-T 9752994-G-T IR3_Prx **
9607592-T-G 9769983-T-G IR3_Prx **
9607713-G-GTC 9770104-G-GTC IR3_Prx **
9735707-G-T 9898098-G-T IR3_Prx **
9941062-T-C 10103453-T-C **
10827982-G-T **
10827964-C-T **
9963369-C-A 10125760-C-A **
10047664-G-T 10210055-G-T **
10050835-C-A 10213226-C-A **
10632711-C-G **
10691210-C-T **
10646023-G-C **
10651497-G-A **
10653710-A-G **
10655371-G-T **
10662487-C-A **
10827939-C-G **
10677867-C-A **
10827935-C-CAGTAA **
10691007-C-A **
10827931-A-T **
10822613-G-T **
7304598-C-A 7436557-C-A **
7436436-C-A 7568395-C-A **
7255476-C-A 7387435-C-A **
6765738-G-T 6897697-G-T **
6577098-C-T 6709057-C-T **
5274970-T-G 5406929-T-G **
6585103-C-A 6717062-C-A FGC65807 **
5235375-T-C 5367334-T-C **
6654000-G-C 6785959-G-C **
6690326-A-T 6822285-A-T **
6765592-G-T 6897551-G-T **
5235272-C-A 5367231-C-A **
5204606-C-A 5336565-C-A **
5316958-A-T 5448917-A-T **
6765747-C-A 6897706-C-A **
5188611-T-C 5320570-T-C **
6769915-C-A 6901874-C-A **
5188609-C-A 5320568-C-A **
6772360-C-A 6904319-C-A **
10844931-T-G **
5126914-T-G 5258873-T-G **
6784537-A-G 6916496-A-G **
6925135-A-C 7057094-A-C **
5316939-C-A 5448898-C-A **
6513457-C-T 6645416-C-T **
5117113-C-A 5249072-C-A **
6109948-T-TAAG 6241907-T-TAAG 10×A**
5465245-G-T 5597204-G-T **
5483781-C-A 5615740-C-A **
5494616-A-G 5626575-A-G **
5818429-C-A 5950388-C-A **
5957019-C-A 6088978-C-A **
6063124-C-A 6195083-C-A **
6093644-T-G 6225603-T-G **
6109940-A-T 6241899-A-T **
6109981-G-A 6241940-G-A **
6492179-T-C 6624138-T-C **
6241002-A-T 6372961-A-T IR3_Dst **
6244085-C-A 6376044-C-A IR3_Dst **
6244189-T-TG 6376148-T-TG IR3_Dst **
6331138-T-C 6463097-T-C IR3_Dst **
6392714-C-A 6524673-C-A **
5397701-A-G 5529660-A-G **
6427319-C-A 6559278-C-A **
6427361-T-C 6559320-T-C **
6469948-C-A 6601907-C-A **
6925597-C-A 7057556-C-A A17617 **
6874811-A-AT 7006770-A-AT **
4957899-T-A 5089858-T-A **
7076279-A-T 7208238-A-T **
4873776-C-A 5005735-C-A **
7142443-C-A 7274402-C-A **
4937316-T-G 5069275-T-G **
4950890-C-A 5082849-C-A **
7142718-C-A 7274677-C-A **
6978385-T-C 7110344-T-C **
7115477-C-T 7247436-C-T **
7098716-A-C 7230675-A-C **
7098651-G-A 7230610-G-A **
7081184-A-G 7213143-A-G A17618 **
4957925-G-C 5089884-G-C **
7081014-A-C 7212973-A-C **
7076423-C-A 7208382-C-A **
7053843-G-C 7185802-G-C **
7152876-C-A 7284835-C-A FT141918 **
5081128-C-A 5213087-C-A **
6983831-T-A 7115790-T-A **
7241122-T-C 7373081-T-C **
7009278-C-A 7141237-C-A **
5050361-C-A 5182320-C-A **
7018050-TTA-T 7150009-TTA-T **
7140877-C-A 7272836-C-A **
4999758-A-G 5131717-A-G **
7235870-G-T 7367829-G-T **
7210024-C-A 7341983-C-A **
16540978-A-G 14429098-A-G ***
23267044-CTT-C,CTTT 21105158-CTT-C,CTTT 13×T***
23364087-CAAAA-C,CA 21202201-CAAAA-C,CA 16×A***
4834245-TA-T 4966204-TA-T 23×A***
19112200-AAC-A 17000320-AAC-A ***
5338087-ATTT-A 5470046-ATTT-A 16×T***
19275207-TAC-T 17163327-TAC-T ***
27039274-A-C 24893127-A-C P1_r4 ***
13858648-T-A,G 11737942-T-A,G ***
19314709-AT-A,ATTTT 17202829-AT-A,ATTTT 17×T***
14698066-CT-C 12586132-CT-C 10×T***
13465445-A-T 11309769-A-T ***
6047272-GA-G 6179231-GA-G 11×A***
5789683-TA-T 5921642-TA-T 10×A***
13848608-A-G 11727902-A-G ***
13848618-C-G 11727912-C-G ***
13711752-CGGAATGGAATTAAAT-C 11556076-CGGAATGGAATTAAAT-C ***
13138825-C-T 10628311-C-T ***
13711226-A-C 11555550-A-C ***
13488737-C-A 11333061-C-A ***
22304012-T-G 20142126-T-G BY22452 DYZ19 ***
22537997-T-C 20376111-T-C ***
13825121-T-A 11704415-T-A ***
18573528-A-G 16461648-A-G ***
10037042-T-C 10199433-T-C S13083 ***
18195154-ATTTT-A,ATTTTT 16083274-ATTTT-A,ATTTTT 29×T***
17794160-T-TC 15682280-T-TC ***
13806188-T-G 11685482-T-G ***
10831652-G-T ***
3271600-A-T 3403559-A-T ***
56842337-C-T ***
13814106-A-T 11693400-A-T ***
13814073-A-T 11693367-A-T ***
13481156-G-C 11325480-G-C ***
19360192-C-T 17248312-C-T V4038 ***
13858570-G-A 11737864-G-A ***
18688500-CAAA-C 16576620-CAAA-C 20×A***
13944051-CAAAAAA-C 11823345-CAAAAAA-C 22×A***
56834620-TTCCATTCCATTTCAC-T,TTCCATTCCATTTCAA ***
56842312-G-A ***
10868084-C-T ***
4698301-G-GA 4830260-G-GA 10×A***
14898434-C-T 12786500-C-T PR5264 ***
28803430-G-A 26657283-G-A ***
14695501-CA-C 12583567-CA-C 10×A***
2855305-CT-C,CTT 2987264-CT-C,CTT 16×T***
9063859-CT-C,CTT 9226250-CT-C,CTT 16×T***
56827781-GTCCATTCCATTCCATTCTAG-G,GTCCATTCCATTCCATTTTAA ***
6588269-G-GT 6720228-G-GT 10×T***
10912361-G-T ***
16309571-CA-C,CAA 14197691-CA-C,CAA 17×A***
3323017-G-GT 3454976-G-GT 10×T***
5468173-C-CT 5600132-C-CT 26×T***
13446750-G-C 11291074-G-C ***
10009345-G-A 10171736-G-A ***
18806063-TG-T 16694183-TG-T ***
13143389-C-A 10632875-C-A ***
14288995-CT-C 12168289-CT-C ***
13307454-T-C 11151778-T-C ***
22962434-TG-T 20800548-TG-T ***
28657147-GAAA-G 26511000-GAAA-G 14×A***
28701702-C-A 26555555-C-A ***
13800541-A-G 11679835-A-G ***
5438997-T-A 5570956-T-A ***
13704324-GAATGGAATGA-G,GAATGGAATGG 11548648-GAATGGAATGA-G,GAATGGAATGG ***
13530101-AAAT-A 11374425-AAAT-A ***
28763615-G-A 26617468-G-A ***
13825148-A-G 11704442-A-G ***
13470110-A-C,G 11314434-A-C,G ***
5646121-TA-T 5778080-TA-T ***
5260410-CAA-C,CA 5392369-CAA-C,CA 20×A***
14825148-C-T 12713215-C-T ***
5107594-A-G 5239553-A-G ***
13829539-C-T 11708833-C-T ***
9046046-A-T 9208437-A-T BY202911 ***
4233467-TAC-T 4365426-TAC-T 13×AC***
5945467-CTTTT-C,CTTT 6077426-CTTTT-C,CTTT 25×T***
15839984-T-C 13728104-T-C ***
21262429-T-A 19100543-T-A ***
9313557-C-T 9475948-C-T A17620 ***
10887468-CATA-C,CATT ***
2700007-C-A 2831966-C-A ***
17604497-C-A 15492617-C-A ***
14359921-C-A 12239216-C-A ***
13694001-T-C 11538325-T-C ***
10934862-C-G ***
13861182-G-A 11740476-G-A ***
7146341-A-T 7278300-A-T ***
14768662-AAT-A 12656731-AAT-A ***
10755358-A-G,T ***
10887453-C-A,T ***
2806030-AT-A,ATT 2937989-AT-A,ATT 16×T***
13446673-T-G 11290997-T-G ***
11642936-C-A ***
10760420-C-CATTCA ***
13488662-A-T 11332986-A-T ***
13461883-C-A 11306207-C-A ***
10776065-CGCTCCACTCA-C,CACTCCA ***
13466412-G-T 11310736-G-T ***
13461829-GGCA-G 11306153-GGCA-G ***
5519905-TAA-T 5651864-TAA-T 13×A***
2702192-C-A 2834151-C-A ***
2817896-AAAAG-A,AAAAA 2949855-AAAAG-A,AAAAA ***
18923163-C-A 16811283-C-A ***
15859455-G-T 13747575-G-T ***
15173782-CAA-C,CAAA 13061868-CAA-C,CAAA 13×A***
15174766-A-G 13062852-A-G ***
15223013-C-A 13111099-C-A F11634 ***
15305885-TAATAG-T,TAG 13193987-TAATAG-T,TAG ***
15315500-C-A 13203606-C-A ***
15430346-C-A 13318466-C-A ***
15726272-C-T 13614392-C-T ***
14750953-GA-G 12639022-GA-G 8×A***
5393328-ACAG-A 5525287-ACAG-A ***
4222950-T-C 4354909-T-C ***
17052705-G-T 14940825-G-T ***
4144063-C-T 4276022-C-T ***
15998156-C-A 13886276-C-A ***
16583453-C-A 14471573-C-A ***
14286827-G-T 12166121-G-T ***
16743214-G-T 14631334-G-T ***
16749684-C-A 14637804-C-A ***
16889894-A-G 14778014-A-G ***
14180746-C-A 12060040-C-A ***
16913274-C-A 14801394-C-A ***
16967239-C-A 14855359-C-A ***
13461828-G-GTTT 11306152-G-GTTT ***
11032449-G-T ***
13811747-G-A 11691041-G-A BY90260 ***
19575932-CCT-C 17464052-CCT-C P5_Prx 10×CT***
10925610-G-T ***
10896345-T-G ***
22485969-G-T 20324083-G-T DYZ19 ***
9798063-G-GTT 9960454-G-GTT 17×T***
21555222-C-T 19393336-C-T ***
58972156-T-A,C 56826009-T-A,C ***
22885912-G-A 20724026-G-A ***
10772345-C-A ***
10773306-C-A ***
10776083-T-C,TATATT ***
10925635-ACTCC-A ***
14515530-CAA-C 12403731-CAA-C 13×A***
13486781-C-G 11331105-C-G ***
13486780-C-T 11331104-C-T ***
25187185-C-T 23041038-C-T g1 ***
24959707-T-C 22813560-T-C g1 ***
23983321-G-T 21837174-G-T ***
22249539-G-C 20087653-G-C DYZ19 ***
15790651-C-A 13678771-C-A ***
13829565-A-T 11708859-A-T ***
13829554-C-T 11708848-C-T ***
22166199-A-T 20004313-A-T ***
10673772-C-A ***
11031635-C-A ***
11014519-T-C ***
7867879-GGAAA-G,GGAAAGAAA 7999838-GGAAA-G,GGAAAGAAA 16×GAAA***
11022869-TTCTTT-T,TTCTTC ***
19275246-G-A 17163366-G-A ***
10888019-T-G ***
19464134-G-T 17352254-G-T ***
8289188-C-A 8421147-C-A ***
8760517-CTTTTTTTT-C,CTTTTTT 8892476-CTTTTTTTT-C,CTTTTTT 20×T***
11003742-CCAC-CTGC,GT ***
19206934-TTATA-T 17095054-TTATA-T 10×TA***
13521039-GAT-G,GATAT 11365363-GAT-G,GATAT 10×AT***
13489618-CA-A,CT 11333942-CA-A,CT ***
9403520-A-T 9565911-A-T ***
13642820-C-A 11487144-C-A ***
10954271-C-A ***
21935002-C-A 19773116-C-A ***
9961051-T-A 10123442-T-A ***
10760401-A-C ***
6915796-ATTT-A 7047755-ATTT-A 22×T***
19393098-CTTTT-C 17281218-CTTTT-C 30×T***
10661033-ACA-A,ACT ***
22002282-C-A 19840396-C-A FGC35008 ***
28700800-T-A 26554653-T-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 389621063957877029957784459
Kit: 38962961536478300187724250
Kit: 389621482472492857098269017
Used in age calculations1482472492857098269017
Counts of SNPs11
Variant counts last updated 2019-10-28 04:28:36.



Big Tree Main Page