Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > ZZ10 > Z253 > ZZ6 > FGC3249 > FGC3236 > FGC3251 > FGC3263 > L430 > FGC3241

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
99512
BigY3
99512
BigY2
99512
FGC
PY5HU
13448443-C-T 11292767-C-T A*
10655060-T-TCCA A*
16210460-C-A 14098580-C-A FGC3219 Z14282 Y+
21049870-GGA-G 18887984-GGA-G 12×GA*
6930708-C-G 7062667-C-G **
6010173-C-A 6142132-C-A **
5167164-T-C 5299123-T-C **
5242855-C-A 5374814-C-A **
5275425-T-C 5407384-T-C **
7042767-C-A 7174726-C-A **
5292252-C-A 5424211-C-A **
5448791-T-C 5580750-T-C **
5449892-A-T 5581851-A-T **
5603908-C-A 5735867-C-A **
5609470-G-A 5741429-G-A **
5688472-T-A 5820431-T-A **
5755871-G-T 5887830-G-T **
5785350-C-A 5917309-C-A **
5976871-G-A 6108830-G-A **
6081837-A-T 6213796-A-T **
6915949-C-T 7047908-C-T **
6092447-C-A 6224406-C-A **
5035555-G-T 5167514-G-T **
6228209-A-AAAAACAC 6360168-A-AAAAACAC IR3_Dst **
6486789-C-A 6618748-C-A **
6486809-C-A 6618768-C-A **
6530652-C-A 6662611-C-A **
6619616-A-G 6751575-A-G **
6654002-A-G 6785961-A-G **
6953403-G-T 7085362-G-T **
6654500-C-A 6786459-C-A **
6663124-G-A 6795083-G-A **
6784337-C-A 6916296-C-A **
6828418-T-A 6960377-T-A **
6868936-C-A 7000895-C-A **
7270327-A-C 7402286-A-C **
4919354-T-A 5051313-T-A **
4957619-A-G 5089578-A-G **
3821578-T-C 3953537-T-C **
3051458-T-G 3183417-T-G **
3105357-G-T 3237316-G-T **
3122347-T-A 3254306-T-A **
3175797-G-A 3307756-G-A **
3178227-A-C 3310186-A-C **
3267377-T-G 3399336-T-G **
3389576-C-A 3521535-C-A **
3445440-T-A 3577399-T-A **
3445446-T-G 3577405-T-G **
3445528-A-T 3577487-A-T **
3448552-G-T 3580511-G-T **
3514351-C-A 3646310-C-A **
3576857-G-T 3708816-G-T **
3591730-A-G 3723689-A-G **
3839041-T-C 3971000-T-C **
4937191-C-A 5069150-C-A **
3847411-C-A 3979370-C-A **
4100672-C-A 4232631-C-A **
4108228-A-G 4240187-A-G **
4214943-C-A 4346902-C-A **
4222745-CA-C 4354704-CA-C 9×A**
4388014-A-G 4519973-A-G **
4388098-A-C 4520057-A-C **
4495462-G-A 4627421-G-A **
4495552-G-A 4627511-G-A **
4540221-A-C 4672180-A-C **
4540656-C-A 4672615-C-A **
4568424-G-T 4700383-G-T **
4626292-T-G 4758251-T-G **
4672258-C-A 4804217-C-A **
7061021-C-G 7192980-C-G **
7081293-A-T 7213252-A-T **
7080206-C-A 7212165-C-A **
10037635-C-A 10200026-C-A **
8709865-GC-G 8841824-GC-G **
8713165-G-A 8845124-G-A **
8790142-C-A 8922101-C-A **
8850756-T-A 8982715-T-A **
8906946-C-A 9038905-C-A **
9140239-G-T 9302630-G-T **
9471738-G-T 9634129-G-T **
9605326-T-TAGTG 9767717-T-TAGTG IR3_Prx **
9852760-C-A 10015151-C-A **
9859112-G-A 10021503-G-A **
9926813-G-A 10089204-G-A **
9946060-A-G 10108451-A-G **
9961306-C-A 10123697-C-A **
10028262-A-G 10190653-A-G **
10060716-C-A 10223107-C-A **
8673920-C-A 8805879-C-A **
10669691-C-G **
10671215-C-A **
10756224-GTCCACTCCACTCCACTCTCCTCAACTACAT-G **
10759942-C-A **
10767971-C-G **
10778959-T-A **
10786213-C-A **
10787188-C-A **
10787661-C-A **
10787949-T-C **
10813315-G-T **
10860262-A-T **
10876617-A-T **
10915721-GT-G **
8677986-C-A 8809945-C-A **
8154166-T-C 8286125-T-C **
2959541-T-G 3091500-T-G **
7313719-C-A 7445678-C-A **
7083762-C-A 7215721-C-A **
7099302-C-A 7231261-C-A **
7115535-G-T 7247494-G-T **
7132172-G-T 7264131-G-T **
7134702-C-A 7266661-C-A **
7152998-C-A 7284957-C-A **
7185349-C-A 7317308-C-A **
7186157-C-A 7318116-C-A **
7186785-C-A 7318744-C-A **
7197330-C-A 7329289-C-A **
7197434-G-A 7329393-G-A **
7243850-C-A 7375809-C-A **
7248524-C-A 7380483-C-A **
7270303-A-TT 7402262-A-TT **
7333873-C-A 7465832-C-A **
8043134-C-A 8175093-C-A **
7353117-C-A 7485076-C-A **
7359827-GA-G 7491786-GA-G **
7362120-C-A 7494079-C-A **
7385609-C-A 7517568-C-A **
7409538-C-A 7541497-C-A **
7418665-C-T 7550624-C-T **
7501288-T-C 7633247-T-C IR1_L **
7621186-C-A 7753145-C-A **
7633189-C-A 7765148-C-A **
7643119-C-A 7775078-C-A **
7699400-C-A 7831359-C-A **
7699409-C-G 7831368-C-G **
7699435-T-A 7831394-T-A **
7717824-G-T 7849783-G-T **
2959601-T-A 3091560-T-A **
2773724-T-G 2905683-T-G **
2948977-A-G 3080936-A-G **
25995485-C-T 23849338-C-T P1_Y1 **
11022013-T-C **
10895831-C-G **
19235197-C-CT 17123317-C-CT 9×T**
14605855-C-A 12494057-C-A **
10822675-C-A **
27417818-G-T 25271671-G-T P1_g3 **
13871961-C-A 11751255-C-A **
11025409-T-C **
26046021-G-T 23899874-G-T P1_Y1 **
20645886-G-T 18484000-G-T P4_Prx **
21426964-C-A 19265078-C-A **
27417823-G-C 25271676-G-C P1_g3 **
26010371-A-T 23864224-A-T P1_Y1 **
26415665-C-A 24269518-C-A P1_Y1 **
5189693-C-A 5321652-C-A **
14570755-CATTTTT-C 12458955-CATTTTT-C **
13480403-T-A 11324727-T-A **
19023207-C-A 16911327-C-A **
7270306-C-A 7402265-C-A **
8389597-GAC-G 8521556-GAC-G **
10925626-T-TTTCTC **
4374796-C-A 4506755-C-A **
10995800-A-T **
16860748-GC-A 14748868-GC-A **
18858626-T-A 16746746-T-A FTB82820 **
10984459-A-C **
10667134-C-A **
18354140-G-T 16242260-G-T P6_Prx **
18688310-C-A 16576430-C-A FGC64203 **
17090875-C-T 14978995-C-T **
10994131-A-T **
56827764-C-T **
10940320-C-A **
27585944-A-G 25439797-A-G P1_Y2 **
58882412-ACATTCGATTTCTTGT-A 56708434-GAATCGAATGACAAGA-G **
22739716-C-CAAAAA 20577830-C-CAAAAA 24×A**
21426991-C-A 19265105-C-A 12×A**
59013638-A-T 56867491-A-T 11×T**
20645876-A-T 18483990-A-T P4_Prx **
24643260-C-T 22497113-C-T P3_t2 **
4334212-TTA-T 4466171-TTA-T **
13941041-T-C 11820335-T-C Y23313 **
15863150-C-A 13751270-C-A PF2355 **
9605319-T-A 9767710-T-A IR3_Prx **
7490451-G-A 7622410-G-A FT390219 IR1_L **
21363027-T-A 19201141-T-A **
15604354-CAAAAAA-C 13492474-CAAAAAA-C 20×A**
19765809-CTTTTTTTTTT-C 17653929-CTTTTTTTTTT-C P5_Prx 22×T**
6978237-C-A 7110196-C-A **
10895870-C-A **
21132671-A-T 18970785-A-T **
19520828-C-A 17408948-C-A **
20242459-CTG-C 18080573-CTG-C P5_Dst **
13447109-T-C 11291433-T-C **
4840743-C-A 4972702-C-A **
19604809-CAAA-C 17492929-CAAA-C P5_Prx 19×A**
4959359-C-A 5091318-C-A **
16181296-C-A 14069416-C-A **
3340689-C-A 3472648-C-A **
10965522-T-C **
15755236-C-A 13643356-C-A **
5275492-G-T 5407451-G-T **
6634257-A-T 6766216-A-T **
5449902-G-T 5581861-G-T **
27647719-C-A 25501572-C-A P1_Y2 **
11671221-C-A **
2795658-C-A 2927617-C-A **
10925654-C-A **
23881908-T-A 21720022-T-A **
20689816-T-TA 18527930-T-TA P4_Prx **
18855431-G-T 16743551-G-T **
3389934-C-A 3521893-C-A **
17703234-T-C 15591354-T-C **
14845520-T-C 12733586-T-C **
15860270-C-A 13748390-C-A **
10825235-C-A **
27417813-G-C 25271666-G-C P1_g3 **
23098803-T-A 20936917-T-A **
9063226-C-A 9225617-C-A **
4063211-C-A 4195170-C-A **
10940338-C-T **
10940288-C-T **
21323492-C-A 19161606-C-A **
2860292-C-A 2992251-C-A **
13973153-C-A 11852447-C-A **
24290683-TAA-T 22144536-TAA-T P3_t1 11×A**
17605076-C-A 15493196-C-A **
22846006-C-A 20684120-C-A **
13945231-C-A 11824525-C-A **
5443904-C-A 5575863-C-A **
21367690-A-T 19205804-A-T 14×T**
25872066-C-A 23725919-C-A P1_Y1 **
6001444-C-A 6133403-C-A **
5247345-C-A 5379304-C-A **
2745216-C-G 2877175-C-G **
2767775-C-A 2899734-C-A **
2767809-A-G 2899768-A-G **
10940273-C-A **
21189667-T-A 19027781-T-A **
7154818-AC-A 7286777-AC-A **
8016938-CTTTTTT-C 8148897-CTTTTTT-C 25×T**
7252408-C-A 7384367-C-A **
10940318-T-A **
2847185-C-A 2979144-C-A **
9596491-C-CTA 9758882-C-CTA IR3_Prx **
20440398-G-GTTT 18278512-G-GTTT P5_Dst **
10916099-G-T **
9967301-C-A 10129692-C-A **
10825295-C-AGGTTA **
13457776-C-A 11302100-C-A **
2906740-C-A 3038699-C-A **
20850616-GT-G 18688730-GT-G P4_Dst **
4616734-C-A 4748693-C-A **
28802763-G-T 26656616-G-T **
15495307-C-A 13383427-C-A **
16220923-C-A 14109043-C-A **
10809516-G-T **
17199520-C-A 15087640-C-A **
18855425-A-G 16743545-A-G **
20332000-G-A 18170114-G-A P5_Dst **
28612148-C-A 26466001-C-A **
19520834-T-C 17408954-T-C **
8154164-G-T 8286123-G-T **
10940326-C-T **
7039842-G-T 7171801-G-T **
10979583-C-A **
13939171-C-A 11818465-C-A **
15712328-C-A 13600448-C-A **
19520825-G-A 17408945-G-A **
14236008-C-A 12115302-C-A **
6177446-A-T 6309405-A-T IR3_Dst **
8058598-C-A 8190557-C-A **
10918107-G-T **
10940282-T-G **
10940276-A-G **
21367714-G-T 19205828-G-T **
20352189-C-T 18190303-C-T P5_Dst **
20387278-A-AT 18225392-A-AT P5_Dst **
20433810-G-T 18271924-G-T P5_Dst **
20612197-G-T 18450311-G-T P4_Prx **
20641629-G-A 18479743-G-A P4_Prx **
20809580-A-T 18647694-A-T P4_Gap **
20989203-G-T 18827317-G-T P4_Dst **
21158995-G-A 18997109-G-A **
21225078-C-A 19063192-C-A **
21263563-C-G 19101677-C-G **
21296584-C-A 19134698-C-A **
21334570-C-A 19172684-C-A Y56556 **
21360339-C-A 19198453-C-A **
21367688-C-T 19205802-C-T **
21368786-A-T 19206900-A-T **
20126671-A-C 18014791-A-C P5_Dst **
21457486-G-A 19295600-G-A **
21614664-C-A 19452778-C-A **
21935103-T-C 19773217-T-C **
22027641-C-A 19865755-C-A **
22091373-C-A 19929487-C-A **
22125651-A-C 19963765-A-C **
22164513-A-G 20002627-A-G **
22309855-A-T 20147969-A-T DYZ19 **
22325291-T-A 20163405-T-A DYZ19 **
22489656-T-A 20327770-T-A DYZ19 **
22602018-A-C 20440132-A-C **
22611377-C-A 20449491-C-A **
22774605-C-A 20612719-C-A **
22775457-T-A 20613571-T-A **
20332008-C-A 18170122-C-A P5_Dst **
19847678-G-A 17735798-G-A P5_Prx **
22991267-C-A 20829381-C-A **
18980500-C-A 16868620-C-A FT188347 **
18685473-C-G 16573593-C-G **
18710190-C-A 16598310-C-A **
18768540-C-A 16656660-C-A **
18779272-C-T 16667392-C-T **
18790584-C-A 16678704-C-A **
18847739-T-C 16735859-T-C **
18848369-G-A 16736489-G-A **
18848519-A-T 16736639-A-T **
18855419-A-T 16743539-A-T **
18855612-G-A 16743732-G-A **
18858634-T-C 16746754-T-C **
18924926-C-A 16813046-C-A **
18928633-T-G 16816753-T-G **
18928971-A-T 16817091-A-T **
19007713-C-A 16895833-C-A **
19844976-G-A 17733096-G-A P5_Prx **
19013250-A-T 16901370-A-T **
19030448-C-A 16918568-C-A **
19052227-T-C 16940347-T-C **
19088459-C-A 16976579-C-A **
19091560-C-A 16979680-C-A **
19121843-C-A 17009963-C-A **
19156120-C-A 17044240-C-A **
19216378-C-A 17104498-C-A **
19235211-T-A 17123331-T-A **
19253059-GC-G 17141179-GC-G **
19296874-T-C 17184994-T-C **
19312259-C-A 17200379-C-A **
19539758-C-A 17427878-C-A **
19785344-A-AG 17673464-A-AG P5_Prx **
22901958-A-C 20740072-A-C **
22995398-G-GT 20833512-G-GT **
18625424-T-A 16513544-T-A **
5975994-A-T 6107953-A-T **
28612250-G-C 26466103-G-C **
28650023-C-T 26503876-C-T **
56695293-T-C **
56827470-T-G **
56842301-A-C **
56842322-T-G **
56844040-C-A **
56850372-A-AT **
56850374-TC-T **
56850410-G-A **
56858043-C-T **
56858047-G-T **
3985968-T-TA 4117927-T-TA 9×A**
19553056-CT-C 17441176-CT-C 8×T**
3441041-G-A 3573000-G-A **
28598960-C-A 26452813-C-A **
3746404-T-C 3878363-T-C **
4039925-T-C 4171884-T-C **
4325868-T-C 4457827-T-C **
4429557-G-A 4561516-G-A **
4742528-C-T 4874487-C-T **
4742533-A-G 4874492-A-G **
5550414-CT-C 5682373-CT-C **
7711974-A-T 7843933-A-T **
8725421-T-C 8857380-T-C **
9721811-A-G 9884202-A-G IR3_Prx **
13460158-G-T 11304482-G-T **
19505439-A-G 17393559-A-G **
20231514-A-AG 18069628-A-AG P5_Dst **
23102845-CT-C 20940959-CT-C **
28610115-C-A 26463968-C-A **
28548553-A-T 26402406-A-T **
22995404-G-C 20833518-G-C **
24512910-G-T 22366763-G-T **
22995408-T-C 20833522-T-C **
23036800-C-A 20874914-C-A **
23126215-TA-T 20964329-TA-T **
23142929-G-A 20981043-G-A **
23196308-T-C 21034422-T-C **
23569171-T-C 21407285-T-C **
23773453-G-T 21611567-G-T **
21751750-A-G **
23954203-G-A 21808056-G-A **
24071619-A-G 21925472-A-G P3_b1 **
24223349-C-A 22077202-C-A P3_b1 **
24416924-C-A 22270777-C-A **
24445522-C-T 22299375-C-T **
24458759-TC-T 22312612-TC-T **
24634053-T-C 22487906-T-C P3_t2 **
28542430-A-G 26396283-A-G **
27607711-G-T 25461564-G-T P1_Y2 **
28537134-G-A 26390987-G-A **
28497063-C-A 26350916-C-A **
28469566-T-C 26323419-T-C **
28469539-G-T 26323392-G-T **
27916366-T-A 25770219-T-A P1_Y2 **
27791745-T-C 25645598-T-C P1_Y2 **
27417831-G-C 25271684-G-C P1_g3 **
24878256-G-T 22732109-G-T g1 **
26777224-C-A 24631077-C-A P1_g2 **
26463141-T-C 24316994-T-C P1_Y1 **
26358850-C-A 24212703-C-A P1_Y1 **
25885894-G-GA 23739747-G-GA P1_Y1 **
24929531-C-A 22783384-C-A g1 **
24929520-T-A 22783373-T-A g1 **
18625942-C-A 16514062-C-A **
18443428-C-T 16331548-C-T P6_Dst **
9957215-C-T 10119606-C-T **
14273430-T-C 12152724-T-C **
13838673-A-G 11717967-A-G **
13859760-T-C 11739054-T-C **
13865715-C-A 11745009-C-A BY26349 **
13882759-G-T 11762053-G-T **
13896987-T-G 11776281-T-G **
13929155-C-T 11808449-C-T **
13936048-C-A 11815342-C-A **
13949641-G-T 11828935-G-T FT346073 **
13963296-C-A 11842590-C-A **
13987267-C-A 11866561-C-A **
13987291-T-G 11866585-T-G **
14236021-T-A 12115315-T-A **
14236026-C-A 12115320-C-A 16×A**
14270004-T-C 12149298-T-C **
14287006-C-A 12166300-C-A Y37744BY3487 **
11652450-G-T **
14296254-C-A 12175548-C-A **
14311690-C-A 12190984-C-A **
14347862-T-C 12227157-T-C **
14350085-C-T 12229380-C-T **
14354380-G-T 12233675-G-T **
14361829-C-A 12241124-C-A **
14369159-G-T 12248455-G-T **
14385395-A-T 12264691-A-T **
14385462-A-T 12264758-A-T **
14443052-C-A 12322325-C-A **
14447990-C-A 12327263-C-A **
14448011-C-A 12327284-C-A **
14609786-C-A 12497988-C-A **
14609789-G-A 12497991-G-A **
11655373-A-T **
11643649-G-T **
14718182-G-T 12606250-G-T **
11019514-C-A **
10940295-C-G **
10958708-C-T **
10971050-C-T **
10972378-C-A **
10972459-C-A **
10972645-C-A **
10979559-A-G **
10980561-C-A **
10985724-C-A **
10986661-N-A **
10994130-C-T **
10994140-C-CTCTCA **
10999284-A-G **
11007075-G-A **
11022021-C-T **
13606471-C-A 11450795-C-A **
11022023-C-CTTGAT **
11031648-T-C **
13227750-C-A 11072074-C-A **
13255188-C-A 11099512-C-A **
13267634-C-A 11111958-C-A **
13280145-C-A 11124469-C-A **
13294206-C-A 11138530-C-A **
13329183-G-T 11173507-G-T **
13394793-A-G 11239117-A-G **
13434690-C-A 11279014-C-A **
13480406-T-C 11324730-T-C **
13483812-C-A 11328136-C-A **
13507059-C-A 11351383-C-A **
13597442-C-A 11441766-C-A **
14609794-C-A 12497996-C-A **
14845545-A-G 12733611-A-G **
18340498-AC-A 16228618-AC-A P6_Prx **
17444834-C-A 15332954-C-A **
16620002-C-A 14508122-C-A **
16686049-C-A 14574169-C-A **
16719618-C-A 14607738-C-A **
16745306-C-A 14633426-C-A **
16921338-C-A 14809458-C-A **
16921437-T-C 14809557-T-C **
16942159-T-C 14830279-T-C **
17032672-C-A 14920792-C-A **
17059830-C-A 14947950-C-A **
17159007-C-T 15047127-C-T **
17175317-G-T 15063437-G-T **
17199539-G-A 15087659-G-A **
17402489-CT-C 15290609-CT-C **
17425117-C-G 15313237-C-G **
17492430-T-C 15380550-T-C **
16464724-A-C 14352844-A-C **
17513908-C-T 15402028-C-T **
17571874-A-G 15459994-A-G **
17730455-C-A 15618575-C-A **
17813506-A-G 15701626-A-G **
17876375-C-T 15764495-C-T **
17922472-T-A 15810592-T-A **
17923636-G-T 15811756-G-T **
18022228-A-C 15910348-A-C **
18127997-C-A 16016117-C-A **
18153794-T-C 16041914-T-C **
18190610-T-C 16078730-T-C FT418548 **
18239038-T-C 16127158-T-C **
18284513-C-A 16172633-C-A P6_Prx **
18288711-C-A 16176831-C-A P6_Prx **
16539784-G-T 14427904-G-T **
16427184-G-A 14315304-G-A **
14908260-C-T 12796327-C-T **
15424639-GAA-G 13312759-GAA-G 10×A**
14910788-C-G 12798855-C-G **
14992906-C-A 12880991-C-A **
14994021-C-A 12882106-C-A **
15092313-C-A 12980402-C-A **
15157556-A-T 13045643-A-T **
15157768-T-C 13045855-T-C **
15157772-G-A 13045859-G-A **
15157778-C-T 13045865-C-T **
15193409-C-A 13081495-C-A Y93232 **
15221920-C-G 13110006-C-G **
15366548-A-G 13254668-A-G **
15374511-C-A 13262631-C-A **
15392510-G-T 13280630-G-T **
15424469-G-A 13312589-G-A **
15503303-C-A 13391423-C-A **
16269371-C-A 14157491-C-A **
15921922-C-A 13810042-C-A **
16245486-C-A 14133606-C-A **
16220932-C-A 14109052-C-A **
16216704-C-A 14104824-C-A **
16180293-G-A 14068413-G-A **
15969779-C-A 13857899-C-A **
15942966-C-A 13831086-C-A **
15901327-G-T 13789447-G-T **
15542643-T-A 13430763-T-A **
15871540-C-A 13759660-C-A **
15870504-C-A 13758624-C-A **
15858398-G-A 13746518-G-A **
15671242-C-A 13559362-C-A **
15650622-C-A 13538742-C-A **
15648613-C-A 13536733-C-A **
24895672-T-A 22749525-T-A g1 **
8699412-A-G 8831371-A-G **
13432553-C-T 11276877-C-T **
13139020-T-G 10628506-T-G **
17201821-C-T 15089941-C-T V63 **
22367063-G-T 20205177-G-T DYZ19 **
22337470-T-C 20175584-T-C FGC7994 DYZ19 **
20326007-C-CTTTTTTT 18164121-C-CTTTTTTT P5_Dst 29×T**
23401471-C-T 21239585-C-T CTS11979 PF3878 **
58840797-TTTCCATTCTCTTCGATTCCATTTCTTTATATTCCATGCCATTCGA-T 56750019-TAGAATGGAATCGAATGGCATGGAATATAAAGAAATGGAATCGAAG-T **
9933972-G-A 10096363-G-A **
9939530-T-G 10101921-T-G **
13453194-CACTCGGGTTCACTCA-C 11297518-CACTCGGGTTCACTCA-C **
13400956-T-G 11245280-T-G **
58844021-CTTCCATTTCCATTCGA-C 56746826-GAATGGAATCGAATGGA-G **
24643277-C-T 22497130-C-T P3_t2 **
16701905-G-T 14590025-G-T **
13457783-A-T 11302107-A-T **
9951888-T-C 10114279-T-C **
58867167-TTTCCATTCCATTTCA-T 56723679-AGGAATGGAATGAAAT-A **
13432725-G-A 11277049-G-A **
22244790-T-G 20082904-T-G FGC71298 DYZ19 **
24643271-G-T 22497124-G-T P3_t2 **
9942475-G-C 10104866-G-C **
58884397-T-A 56706474-A-T **
22360892-C-G 20199006-C-G DYZ19 **
6971774-C-A 7103733-C-A **
58843970-G-C 56746901-C-G **
13432706-C-T 11277030-C-T **
58967719-A-G 56821572-A-G **
13405635-C-G 11249959-C-G Z7994 **
22491548-T-C 20329662-T-C DYZ19 ***
58826761-T-A 56764110-A-T ***
58823200-A-C 56767671-T-G ***
22457200-C-G 20295314-C-G DYZ19 ***
58820351-T-C 56770520-A-G ***
22503396-A-C 20341510-A-C DYZ19 ***
22502509-G-A 20340623-G-A DYZ19 ***
22496172-T-A 20334286-T-A DYZ19 ***
22496111-T-A 20334225-T-A DYZ19 ***
22480740-G-A 20318854-G-A DYZ19 ***
22481674-T-A 20319788-T-A DYZ19 ***
22496079-G-T 20334193-G-T DYZ19 ***
58843494-C-T 56747377-G-A ***
58838379-G-C 56752492-C-G ***
58914235-T-G 56676636-A-C ***
10801700-T-TTGAATCCATA ***
58986788-GGC-AGT 56840641-GGC-AGT ***
10846973-C-T ***
10850586-A-T ***
22346872-GG-AA 20184986-GG-AA DYZ19 ***
10868959-C-A ***
22346808-TACC-CAGT 20184922-TACC-CAGT DYZ19 ***
10889294-A-T ***
13203943-TGA-GGT 11048267-TGA-GGT ***
13203908-CACGGCGATG-AATGGTGATA 11048232-CACGGCGATG-AATGGTGATA ***
58914440-T-C 56676431-A-G ***
58890316-C-A 56700555-G-T ***
58841073-C-T 56749798-G-A ***
58885346-C-T 56705525-G-A ***
10956570-A-G ***
58874574-C-G 56716297-G-C ***
58874543-C-A 56716328-G-T ***
58873046-T-C 56717825-A-G ***
58872625-T-C 56718246-A-G ***
58850667-T-A 56740204-A-T ***
58843794-T-C 56747077-A-G ***
58843530-G-C 56747341-C-G ***
13437414-C-A 11281738-C-A ***
58843467-G-C 56747404-C-G ***
58841096-T-C 56749775-A-G ***
22421942-T-G 20260056-T-G DYZ19 ***
22366728-A-G 20204842-A-G DYZ19 ***
13463557-C-A 11307881-C-A ***
22257175-C-G 20095289-C-G DYZ19 ***
22300957-G-A 20139071-G-A DYZ19 ***
22292945-G-A 20131059-G-A DYZ19 ***
22292936-G-C 20131050-G-C DYZ19 ***
22292886-C-G 20131000-C-G DYZ19 ***
22289732-G-A 20127846-G-A DYZ19 ***
22289661-G-A 20127775-G-A DYZ19 ***
22282084-C-T 20120198-C-T DYZ19 ***
14444611-AGAGTAATAATAGTAGACAAATGATGAAAAATATG-A 12323884-AGAGTAATAATAGTAGACAAATGATGAAAAATATG-A ***
22268293-A-G 20106407-A-G DYZ19 ***
22257269-C-G 20095383-C-G DYZ19 ***
22257240-C-A 20095354-C-A DYZ19 ***
22256989-C-A 20095103-C-A DYZ19 ***
22300978-A-G 20139092-A-G DYZ19 ***
14716727-C-A 12604795-C-A ***
22252852-G-T 20090966-G-T DYZ19 ***
22252723-T-A 20090837-T-A DYZ19 ***
14847004-C-A 12735070-C-A 20×A***
22252713-G-T 20090827-G-T BY6573 DYZ19 ***
22252712-G-T 20090826-G-T DYZ19 ***
22252698-T-C 20090812-T-C DYZ19 ***
22251566-A-C 20089680-A-C DYZ19 ***
22251553-G-A 20089667-G-A FGC80266 DYZ19 ***
22249462-T-C 20087576-T-C DYZ19 ***
22236671-T-G 20074785-T-G DYZ19 ***
22300959-T-G 20139073-T-G DYZ19 ***
22335655-G-C 20173769-G-C DYZ19 ***
22421801-A-G 20259915-A-G DYZ19 ***
22360864-A-T 20198978-A-T DYZ19 ***
22421751-C-G 20259865-C-G DYZ19 ***
22421742-G-A 20259856-G-A DYZ19 ***
13585537-C-A 11429861-C-A ***
22366759-A-T 20204873-A-T DYZ19 ***
22366743-T-G 20204857-T-G DYZ19 ***
22480847-TC-AA 20318961-TC-AA DYZ19 ***
22366714-A-T 20204828-A-T DYZ19 ***
22366688-G-T 20204802-G-T DYZ19 ***
22361234-C-A 20199348-C-A DYZ19 ***
22361221-G-T 20199335-G-T DYZ19 ***
22361213-A-C 20199327-A-C DYZ19 ***
22360862-T-C 20198976-T-C DYZ19 ***
22337480-C-T 20175594-C-T DYZ19 ***
22360669-G-T 20198783-G-T DYZ19 ***
13932752-G-A 11812046-G-A ***
22360398-C-T 20198512-C-T FGC80542 DYZ19 ***
22360117-T-G 20198231-T-G DYZ19 ***
22358530-G-A 20196644-G-A DYZ19 ***
22353445-A-G 20191559-A-G DYZ19 ***
22353416-G-T 20191530-G-T DYZ19 ***
14061366-ATTT-A,ATTTTT 11940660-ATTT-A,ATTTTT 17×T***
14108530-C-A 11987824-C-A ***
22342674-G-A 20180788-G-A DYZ19 ***
22342669-G-A 20180783-G-A DYZ19 ***
22342662-C-T 20180776-C-T DYZ19 ***
22352949-CC-GT 20191063-CC-GT DYZ19 ***
22256943-GTATGTCCAGAG-ATTTCTCCTGAC 20095057-GTATGTCCAGAG-ATTTCTCCTGAC DYZ19 ***
22480877-TT-CG 20318991-TT-CG DYZ19 ***
22366697-TTT-AAG 20204811-TTT-AAG DYZ19 ***
22502169-CCG-TCT 20340283-CCG-TCT DYZ19 ***
22496075-TTTAG-GTTAT 20334189-TTTAG-GTTAT DYZ19 ***
22495737-AGTG-TGTT 20333851-AGTG-TGTT DYZ19 ***
22488489-GGTTTCTGT-AGTGTCTTC 20326603-GGTTTCTGT-AGTGTCTTC DYZ19 ***
22480883-TTTCG-GTTCA 20318997-TTTCG-GTTCA DYZ19 ***
22480776-ATCTT-TTCAC 20318890-ATCTT-TTCAC DYZ19 ***
22480694-ATTAAAGT-CTTAAAGG 20318808-ATTAAAGT-CTTAAAGG DYZ19 ***
22457249-CTTT-TTTA 20295363-CTTT-TTTA DYZ19 ***
22435744-TGA-AGC 20273858-TGA-AGC DYZ19 ***
22366755-AGAGA-GGAGT 20204869-AGAGA-GGAGT DYZ19 ***
22366714-ACT-TCG 20204828-ACT-TCG DYZ19 ***
22366649-ATT-GTG 20204763-ATT-GTG DYZ19 ***
28814922-GA-CT 26668775-GA-CT ***
22366638-ATCCTT-TTTCTG 20204752-ATCCTT-TTTCTG DYZ19 ***
22366506-CAA-GAG 20204620-CAA-GAG DYZ19 ***
22366039-GT-TC 20204153-GT-TC DYZ19 ***
22365977-GGTGG-TGTCA 20204091-GGTGG-TGTCA DYZ19 ***
22365948-CT-AG 20204062-CT-AG DYZ19 ***
22365859-GCA-TAG 20203973-GCA-TAG DYZ19 ***
22364589-CCG-TCT 20202703-CCG-TCT DYZ19 ***
22360862-TGA-CAT 20198976-TGA-CAT DYZ19 ***
22360592-GTGT-CTGG 20198706-GTGT-CTGG DYZ19 ***
6980126-G-A 7112085-G-A SK2356 ***
22341764-CATGG-AATGC 20179878-CATGG-AATGC DYZ19 ***
22341613-ACAGA-CCAGT 20179727-ACAGA-CCAGT DYZ19 ***
22502435-GCAGT-ACAGC 20340549-GCAGT-ACAGC DYZ19 ***
28819315-GG-TT 26673168-GG-TT ***
22337576-GTCC-TTCG 20175690-GTCC-TTCG DYZ19 ***
58884397-TG-AT 56706473-CA-AT ***
22480926-C-G 20319040-C-G DYZ19 ***
22268187-T-C 20106301-T-C DYZ19 ***
22263783-T-G 20101897-T-G DYZ19 ***
13440814-A-G 11285138-A-G ***
22457231-C-G 20295345-C-G DYZ19 ***
58890048-A-T 56700823-T-A ***
5785679-GAAAG-AAAAA 5917638-GAAAG-AAAAA ***
3850009-C-A 3981968-C-A ***
59007432-C-CTTTA 56861285-C-CTTTA 18×T***
58987557-TTGT-CTGC 56841410-TTGT-CTGC ***
58985694-TCT-GCA 56839547-TCT-GCA ***
58978909-GCCAA-TCCAC 56832762-GCCAA-TCCAC ***
58884236-TCCGTTTGATGCCATC-T 56706617-TGGGATGGCATCAAAC-T ***
58840728-CTG-TTC 56750141-CAG-GAA ***
58872956-CATTCAA-GATTTAG 56717909-TTGAATG-CTAAATC ***
58869098-TTTCT-ATTCC 56721769-AGAAA-GGAAT ***
58866592-TG-AT 56724278-CA-AT ***
58866552-CCC-ACA 56724317-GGG-TGT ***
58846417-TTCCATTTCATATTATTCCATTCCATTCAAA-T 56744417-GAATGGATTTGAATGGAATGGAATAATATGA-G ***
58844015-TATTCACTTCCATTTCC-T 56746835-CGAATGGAAATGGAAGT-C ***
58843970-GATG-CATT 56746898-CATC-AATG ***
58843820-ACTTCCAGAACATTCCA-CTTTCGACACCCAGCCT 56747035-TGGAATGTTCTGGAAGT-AGGCTGGGTGTCGAAAG ***
58843537-TTT-GTC 56747332-AAA-GAC ***
58843502-T-TA 56747368-A-AT ***
5186735-C-A 5318694-C-A ***
58843446-GT-AC 56747424-AC-GT ***
22341394-ACTTC-TCTTG 20179508-ACTTC-TCTTG DYZ19 ***
22337567-AGG-TGT 20175681-AGG-TGT DYZ19 ***
22480871-TC-GT 20318985-TC-GT DYZ19 ***
13140009-CG-C 10629495-CG-C ***
13708231-AT-TA 11552555-AT-TA ***
13695338-TATCA-CATCG 11539662-TATCA-CATCG ***
27232111-T-TTTTCTTTCTTTC 25085964-T-TTTTCTTTCTTTC P1_g3 18×TTTC***
13695204-GTTGT-CTTGA 11539528-GTTGT-CTTGA ***
13692920-TAAA-GAAT 11537244-TAAA-GAAT ***
13688265-CGGA-TGGG 11532589-CGGA-TGGG ***
13488988-AGGGT-GGGGC 11333312-AGGGT-GGGGC ***
13203922-CGGCATTG-TGGTATTA 11048246-CGGCATTG-TGGTATTA ***
13140033-TA-T 10629519-TA-T ***
13140029-CA-C 10629515-CA-C ***
13140018-GAGTG-CATT 10629504-GAGTG-CATT ***
13140001-CG-C 10629487-CG-C ***
20569614-C-CAAAAAAA 18407728-C-CAAAAAAA P5_Dst 33×A***
13139992-CA-C 10629478-CA-C ***
13129671-ATTTA-GCCCT 10619157-ATTTA-GCCCT ***
13129659-AT-A 10619145-AT-A ***
10011673-GATAG-AATAA 10174064-GATAG-AATAA ***
9940615-TC-CA 10103006-TC-CA ***
22341741-CAGTTTA-GATTTTC 20179855-CAGTTTA-GATTTTC DYZ19 ***
22263730-CG-AT 20101844-CG-AT DYZ19 ***
22234674-C-G 20072788-C-G DYZ19 ***
22295948-AGT-TAC 20134062-AGT-TAC DYZ19 ***
22268405-AC-GA 20106519-AC-GA DYZ19 ***
22263754-ATA-CTT 20101868-ATA-CTT DYZ19 ***
22480908-AT-GC 20319022-AT-GC DYZ19 ***
8654027-A-T 8785986-A-T ***
21824255-C-CAAAAA 19662369-C-CAAAAA 30×A***
22337544-TACGG-CACGC 20175658-TACGG-CACGC DYZ19 ***
22256931-GTGGTCC-TTGTTAA 20095045-GTGGTCC-TTGTTAA DYZ19 ***
22337437-ACTTA-CCTTG 20175551-ACTTA-CCTTG DYZ19 ***
22337234-GG-AA 20175348-GG-AA DYZ19 ***
22337200-CATGTCC-TATTTCG 20175314-CATGTCC-TATTTCG DYZ19 ***
22335999-TT-GG 20174113-TT-GG DYZ19 ***
22297122-ATCT-TTCA 20135236-ATCT-TTCA DYZ19 ***
22289530-GAGA-CAGG 20127644-GAGA-CAGG DYZ19 ***
22281901-AAT-GAG 20120015-AAT-GAG DYZ19 ***
22268371-GC-G 20106485-GC-G DYZ19 ***
22263699-GTCC-TTCG 20101813-GTCC-TTCG DYZ19 ***
22257238-AAC-CAA 20095352-AAC-CAA DYZ19 ***
22257222-AGT-GGA 20095336-AGT-GGA DYZ19 ***
22257146-GAGTT-AAGTG 20095260-GAGTT-AAGTG DYZ19 ***
22256920-ATT-GTG 20095034-ATT-GTG DYZ19 ***
22226585-GAGCT-CAGCA 20064699-GAGCT-CAGCA DYZ19 ***
22256885-GA-CC 20094999-GA-CC DYZ19 ***
22252800-CACT-GACC 20090914-CACT-GACC DYZ19 ***
22252775-AA-CT 20090889-AA-CT DYZ19 ***
22252760-TTCCAAAGTT-GTTTAGATTG 20090874-TTCCAAAGTT-GTTTAGATTG DYZ19 ***
22252712-GGTAG-TTTAC 20090826-GGTAG-TTTAC DYZ19 ***
22252662-ACATGGT-TCAATGA 20090776-ACATGGT-TCAATGA DYZ19 ***
22249354-GTGT-TTGA 20087468-GTGT-TTGA DYZ19 ***
22236668-AGAT-GAAG 20074782-AGAT-GAAG DYZ19 ***
22235145-AAAAT-GAAAC 20073259-AAAAT-GAAAC DYZ19 ***
22232190-GTGCTGT-TTTCTGA 20070304-GTGCTGT-TTTCTGA DYZ19 ***
22232165-CAAA-AAAT 20070279-CAAA-AAAT DYZ19 ***
22228032-AC-TG 20066146-AC-TG DYZ19 ***
22236520-T-A 20074634-T-A Z3458 DYZ19 ***
22227924-T-G 20066038-T-G DYZ19 ***
22234656-C-T 20072770-C-T DYZ19 ***
28785789-A-G 26639642-A-G ***
58834802-T-C 56756069-A-G ***
13686927-G-C 11531251-G-C ***
13686921-T-C 11531245-T-C ***
13686920-A-T 11531244-A-T ***
24895682-TC-T 22749535-TC-T g1 ***
6238667-GCA-G 6370626-GCA-G IR3_Dst ***
28801742-T-G 26655595-T-G ***
24209830-GA-G 22063683-GA-G P3_b1 11×A***
22489904-T-C 20328018-T-C DYZ19 ***
13686897-C-T 11531221-C-T FT448434 ***
13686888-G-A 11531212-G-A ***
13833426-G-C 11712720-G-C ***
13833439-T-A,G 11712733-T-A,G ***
13676703-A-G 11521027-A-G ***
13485847-A-G 11330171-A-G ***
28621222-C-A 26475075-C-A ***
28801724-C-G 26655577-C-G ***
28658368-G-T 26512221-G-T ***
28785779-A-G 26639632-A-G ***
13446748-C-G 11291072-C-G ***
56834444-ATTCCCTTCCATTCCA-A,ATTCCCTTCCATTCCATTCCATTCCC ***
13446730-T-C 11291054-T-C ***
13139327-C-T 10628813-C-T ***
13805380-T-G 11684674-T-G ***
13833435-T-A 11712729-T-A ***
28800159-A-G 26654012-A-G ***
13862260-G-C 11741554-G-C ***
22504630-T-G 20342744-T-G DYZ19 ***
22481300-A-C 20319414-A-C DYZ19 ***
22342953-A-G 20181067-A-G DYZ19 ***
28785797-T-G 26639650-T-G ***
22244998-C-G 20083112-C-G DYZ19 ***
13143631-T-A 10633117-T-A ***
13458412-ATTCCC-A 11302736-ATTCCC-A ***
22239352-T-A 20077466-T-A DYZ19 ***
22250232-A-G 20088346-A-G DYZ19 ***
58841099-C-T 56749772-G-A ***
13838607-A-G 11717901-A-G ***
13702068-A-G 11546392-A-G ***
9968273-T-C 10130664-T-C ***
22503403-C-G 20341517-C-G DYZ19 ***
9968263-C-T 10130654-C-T ***
13843909-C-G 11723203-C-G ***
23833024-C-A 21671138-C-A FT182836 ***
13689209-TCAAAA-T,TGGAAT 11533533-TCAAAA-T,TGGAAT ***
13862191-G-A 11741485-G-A FT273840 ***
13661960-G-A 11506284-G-A BY54290 ***
13649665-A-T 11493989-A-T ***
13649664-T-C 11493988-T-C ***
13649654-A-T 11493978-A-T ***
24502900-C-A 22356753-C-A ***
13649651-G-C 11493975-G-C ***
13194867-T-C 11039191-T-C ***
18997791-A-AT 16885911-A-AT 10×T***
13661952-A-G 11506276-A-G ***
17518695-T-C 15406815-T-C ***
13458433-C-T 11302757-C-T ***
13330393-G-A 11174717-G-A ***
13353349-A-G 11197673-A-G ***
13421184-T-C 11265508-T-C ***
58974053-T-C 56827906-T-C ***
13469326-A-G 11313650-A-G ***
13608647-CAAAA-C,CAAAAA 11452971-CAAAA-C,CAAAAA 27×A***
14108733-A-G 11988027-A-G ***
14109354-AC-A 11988648-AC-A ***
14784730-C-T 12672800-C-T ***
16357152-G-C 14245272-G-C ***
18442944-C-T 16331064-C-T P6_Dst ***
13715219-C-T 11559543-C-T ***
19388387-A-G 17276507-A-G ***
19439711-C-T 17327831-C-T ***
28804552-T-C 26658405-T-C S714 ***
22342845-A-G 20180959-A-G DYZ19 ***
21141211-T-C 18979325-T-C ***
22639887-T-C 20478001-T-C ***
13697758-G-T 11542082-G-T ***
23838183-C-A 21676297-C-A ***
24434596-G-A 22288449-G-A ***
24885402-A-G 22739255-A-G g1 ***
28508007-CAAAA-C 26361860-CAAAA-C 14×A***
13485827-T-C,G 11330151-T-C,G ***
7391954-T-C 7523913-T-C ***
13475589-C-G 11319913-C-G ***
2745250-G-C 2877209-G-C ***
18645948-CTT-C 16534068-CTT-C 10×T***
13848339-G-GA 11727633-G-GA ***
13848314-A-G 11727608-A-G ***
8704030-C-CTT 8835989-C-CTT 13×T***
3389049-TAAAAA-T 3521008-TAAAAA-T 10×A***
21785528-TA-T 19623642-TA-T 9×A***
13478869-C-T 11323193-C-T ***
13818655-G-A 11697949-G-A ***
3079722-TAA-T,TA 3211681-TAA-T,TA 14×A***
13818647-T-G 11697941-T-G ***
6604084-CT-C,CTT 6736043-CT-C,CTT 17×T***
13805045-C-T 11684339-C-T ***
7301775-G-A 7433734-G-A ***
13715220-A-T 11559544-A-T ***
3785900-G-A 3917859-G-A ***
3958063-T-C 4090022-T-C ***
9940864-A-AAT 10103255-A-AAT ***
4158596-CTT-C,CT 4290555-CTT-C,CT 17×T***
26169893-TA-T 24023746-TA-T P1_Y1 10×A***
28799806-T-A 26653659-T-A ***
13461115-T-C 11305439-T-C ***
28804551-C-T 26658404-C-T ***
13802950-G-A 11682244-G-A ***
5889818-A-AT 6021777-A-AT ***
13845622-T-A 11724916-T-A ***
58974000-C-G 56827853-C-G ***
22234625-C-A 20072739-C-A DYZ19 ***
22419678-N-C 20257792-N-C DYZ19 ***
22421811-C-T 20259925-C-T DYZ19 ***
22236558-A-G 20074672-A-G Z3459 DYZ19 ***
22256920-A-G 20095034-A-G DYZ19 ***
22365977-G-T 20204091-G-T DYZ19 ***
22292897-A-C 20131011-A-C DYZ19 ***
22341656-G-C 20179770-G-C DYZ19 ***
22257238-A-C 20095352-A-C DYZ19 ***
17403747-C-A 15291867-C-A ***
22263737-G-T 20101851-G-T Z3468 DYZ19 ***
22263714-C-T 20101828-C-T DYZ19 ***
22341791-A-G 20179905-A-G DYZ19 ***
22252899-A-C 20091013-A-C DYZ19 ***
22491685-C-G 20329799-C-G DYZ19 ***
22292975-T-G 20131089-T-G DYZ19 ***
22419677-N-G 20257791-N-G DYZ19 ***
58881774-C-T 56709097-G-A ***
22297317-C-G 20135431-C-G DYZ19 ***
22252689-C-A 20090803-C-A DYZ19 ***
22268366-T-A 20106480-T-A DYZ19 ***
22257011-A-C 20095125-A-C DYZ19 ***
18218796-TG-T 16106916-TG-T ***
22421962-T-A 20260076-T-A DYZ19 ***
13485503-T-C 11329827-T-C ***
22352897-A-T 20191011-A-T DYZ19 ***
22309684-A-G 20147798-A-G DYZ19 ***
22256936-C-A 20095050-C-A DYZ19 ***
22352439-G-T 20190553-G-T DYZ19 ***
14258526-A-C 12137820-A-C ***
15320599-G-T 13208705-G-T ***
22234614-G-A 20072728-G-A DYZ19 ***
22232221-T-A 20070335-T-A DYZ19 ***
22232180-A-G 20070294-A-G DYZ19 ***
15423436-C-T 13311556-C-T ***
22232151-G-C 20070265-G-C BY1843 DYZ19 ***
22232065-G-A 20070179-G-A DYZ19 ***
22231859-C-G 20069973-C-G S3071 DYZ19 ***
22231796-C-T 20069910-C-T DYZ19 ***
22227923-C-G 20066037-C-G DYZ19 ***
22227906-A-C 20066020-A-C DYZ19 ***
13129686-A-T 10619172-A-T ***
22292872-T-G 20130986-T-G DYZ19 ***
13129655-A-G 10619141-A-G ***
13129640-G-T 10619126-G-T ***
13129629-A-G 10619115-A-G ***
13129553-T-A 10619039-T-A ***
13129484-A-G 10618970-A-G ***
13129469-G-T 10618955-G-T ***
13129458-A-G 10618944-A-G ***
13129423-G-A 10618909-G-A ***
13129415-G-T 10618901-G-T ***
9951870-C-A 10114261-C-A ***
22256937-C-A 20095051-C-A DYZ19 ***
22257262-A-C 20095376-A-C DYZ19 ***
58895403-A-C 56695468-T-G ***
16494380-GAT-G 14382500-GAT-G 8×AT***
13808675-G-A 11687969-G-A ***
13676708-C-G 11521032-C-G ***
22502591-G-T 20340705-G-T DYZ19 ***
22503169-T-C 20341283-T-C A4407 DYZ19 ***
13838554-A-G 11717848-A-G ***
13676718-T-G 11521042-T-G ***
13454001-C-G 11298325-C-G ***
21146260-A-T 18984374-A-T ***
26297068-CAT-C 24150921-CAT-C P1_Y1 ***
21162662-C-A 19000776-C-A ***
13143798-T-C 10633284-T-C ***
28785798-G-A 26639651-G-A ***
58912938-A-C 56677933-T-G ***
13473618-G-A 11317942-G-A ***
13649650-T-C 11493974-T-C BY87021 ***
13457781-G-T 11302105-G-T ***
13818653-T-C 11697947-T-C ***
21531424-T-C 19369538-T-C ***
26882139-TA-T 24735992-TA-T P1_r3 11×A***
22358487-G-A 20196601-G-A DYZ19 ***
21993870-C-T 19831984-C-T ***
13485820-T-G 11330144-T-G ***
13141293-C-A 10630779-C-A ***
22102507-T-A 19940621-T-A ***
13143778-TCCACTGCACTGCACA-T 10633264-TCCACTGCACTGCACA-T ***
13676603-A-G 11520927-A-G ***
9968277-A-T 10130668-A-T ***
22252895-C-T 20091009-C-T DYZ19 ***
28799786-C-T 26653639-C-T 4×GGAGT***
22480883-T-G 20318997-T-G DYZ19 ***
22268200-G-T 20106314-G-T DYZ19 ***
13606903-G-A 11451227-G-A ***
13420035-C-A 11264359-C-A ***
22353378-T-C 20191492-T-C DYZ19 ***
58843973-G-T 56746898-C-A ***
58907253-C-T 56683618-G-A ***
9940587-A-T 10102978-A-T FT361940 ***
58977018-T-A 56830871-T-A ***
58976909-T-C 56830762-T-C ***
28801639-G-A 26655492-G-A ***
27791872-T-G 25645725-T-G P1_Y2 ***
13456219-T-C 11300543-T-C S13825 ***
22345513-G-T 20183627-G-T DYZ19 ***
22253730-T-G 20091844-T-G DYZ19 *********
13853060-AGGGAG-A 11732354-AGGGAG-A ***
13826087-A-T 11705381-A-T ***
13801483-C-A 11680777-C-A ***
13801424-G-A 11680718-G-A ***
13676583-A-G 11520907-A-G ***
13649710-G-A 11494034-G-A ***
13649708-A-C 11494032-A-C ***
19351063-T-C 17239183-T-C ***
13474008-C-G,T 11318332-C-G,T ***
13458578-T-A 11302902-T-A ***
13440967-C-A 11285291-C-A ***
28804491-ATGAAT-GTGGAG 26658344-ATGAAT-GTGGAG ***
58820332-CATTCA-C 56770529-GGAATT-G ***
58843684-A-C 56747187-T-G ***
58868662-G-A 56722209-C-T ***
22289731-TG-GA 20127845-TG-GA DYZ19 ***
22495764-CTTG-GTT 20333878-CTTG-GTT DYZ19 ***
13255004-C-T 11099328-C-T ***
22499088-G-C 20337202-G-C DYZ19 ***
22499104-G-A 20337218-G-A DYZ19 ***
58840476-A-C 56750395-T-G ***
10049572-T-C 10211963-T-C ***
13422277-C-T 11266601-C-T ***
22289483-G-A 20127597-G-A DYZ19 ***
58843666-T-A 56747205-A-T ***
22236518-GATGG-TAAGA 20074632-GATGG-TAAGA DYZ19 ***
58843685-G-C 56747186-C-G ***
22236485-A-T 20074599-A-T DYZ19 ***
27462492-C-A 25316345-C-A P1_Y2 ***
13142443-GCCAGTC-TG 10631929-GCCAGTC-TG ***
22289463-A-G 20127577-A-G DYZ19 ***
22342832-T-A 20180946-T-A DYZ19 ***
13467653-AGAAT-GCAAG 11311977-AGAAT-GCAAG ***
4189326-G-A 4321285-G-A ***
13253111-G-A 11097435-G-A ***
14409001-TTC-T 12288299-TTC-T ***
18723887-C-T 16612007-C-T 19×T***
19478117-T-G 17366237-T-G FT400466 ***
58895649-C-A 56695222-G-T ***
58843619-CGTTTCG-GGAGTCA 56747246-CGAAACG-TGACTCC ***
58870180-T-A 56720691-A-T ***
58913060-G-C 56677811-C-G ***
58891545-TG-AT 56699325-CA-AT ***
19187385-A-ATTTTTT 17075505-A-ATTTTTT 28×T***
22281896-TCT-GTC 20120010-TCT-GTC DYZ19 ***
13616629-G-A 11460953-G-A ***
13473398-G-T 11317722-G-T ***
22234348-C-T 20072462-C-T DYZ19 ***
22342963-A-C 20181077-A-C DYZ19 ***
22367933-G-A 20206047-G-A DYZ19 ***
22501960-A-T 20340074-A-T DYZ19 ***
22501987-A-T 20340101-A-T DYZ19 ***
58852349-G-A 56738522-C-T ***
58848719-TG-AT 56742151-CA-AT ***
23951427-N-T 21805280-N-T ***
23951427-N-NT 21805280-N-NT ***
22273695-C-G 20111809-C-G DYZ19 ***
13616457-G-T 11460781-G-T ***
22273708-C-T 20111822-C-T DYZ19 ***
58877059-AGCGGA-C 56713807-TCCGCT-G ***
28556469-T-G 26410322-T-G ***
13203979-CTC-TAT 11048303-CTC-TAT ***
58843643-C-T 56747228-G-A 4×CCATT***
13142458-GCCACTCTACTT-TCCTCTCCACTC 10631944-GCCACTCTACTT-TCCTCTCCACTC ***
22265873-GC-TG 20103987-GC-TG DYZ19 ***
58846787-G-A 56744084-C-T ***
58846796-A-G 56744075-T-C ***
22244926-GA-G 20083040-GA-G DYZ19 ***
59013637-TA-T 56867490-TA-T ***
22501937-A-C 20340051-A-C DYZ19 ***
22481826-G-T 20319940-G-T DYZ19 ***
18398155-G-A 16286275-G-A P6_Gap ***
9680117-C-T 9842508-C-T IR3_Prx ***
10025210-C-T 10187601-C-T ***
13363961-C-A 11208285-C-A ***
13467614-A-T 11311938-A-T ***
13473420-T-A 11317744-T-A ***
13476385-A-T 11320709-A-T ***
13479871-G-T 11324195-G-T ***
13480045-G-C 11324369-G-C ***
13726528-T-C 11570852-T-C ***
13733917-G-T 11578241-G-T ***
17716176-T-C 15604296-T-C ***
19012969-A-C 16901089-A-C ***
4913977-T-A 5045936-T-A ***
19769971-G-T 17658091-G-T P5_Prx ***
19775300-G-T 17663420-G-T P5_Prx ***
20522263-A-G 18360377-A-G P5_Dst ***
20522277-T-C 18360391-T-C P5_Dst ***
20522307-G-A 18360421-G-A P5_Dst ***
20522328-A-T 18360442-A-T P5_Dst ***
20522550-T-C 18360664-T-C P5_Dst ***
20522556-G-C 18360670-G-C P5_Dst ***
20574016-C-A 18412130-C-A P5_Dst ***
22265940-T-A 20104054-T-A DYZ19 ***
22265965-T-A 20104079-T-A DYZ19 ***
22276528-T-G 20114642-T-G DYZ19 ***
9194845-C-T 9357236-C-T ***
13480091-C-T 11324415-C-T ***
58846526-T-C 56744345-A-G ***
22361164-T-C 20199278-T-C DYZ19 ***
22360576-G-T 20198690-G-T DYZ19 ***
24207516-A-C 22061369-A-C FGC38958 P3_b1 ***
19183814-C-CTTTTT 17071934-C-CTTTTT 28×T***
22501919-C-T 20340033-C-T DYZ19 ***
13701968-T-A 11546292-T-A ***
22421464-C-T 20259578-C-T DYZ19 ***
22496008-C-G 20334122-C-G DYZ19 ***
13484331-A-G 11328655-A-G ***
9871665-TAC-T 10034056-TAC-T 8×AC***
22360566-C-T 20198680-C-T DYZ19 ***
4026316-G-A 4158275-G-A ***
22498439-T-G 20336553-T-G DYZ19 ***
14025624-GAAA-G 11904918-GAAA-G ***
13467524-A-G 11311848-A-G ***
14101423-ATTC-A 11980717-ATTC-A ***
14530900-GTA-G 12419101-GTA-G ***
22344756-C-T 20182870-C-T DYZ19 ***
22266217-T-C 20104331-T-C DYZ19 ***
10024136-G-T 10186527-G-T ***
22236668-A-G 20074782-A-G DYZ19 ***
13482882-CT-AA 11327206-CT-AA ***
3350514-CA-C 3482473-CA-C 15×A***
22481719-G-T 20319833-G-T DYZ19 ***
58882530-GTCCATTCCGTTCGAT-G 56708307-GGGAATCGAACGGAAT-G ***
22236469-C-T 20074583-C-T DYZ19 ***
13479873-G-A 11324197-G-A ***
13461950-TGGT-AGGC 11306274-TGGT-AGGC ***
22342816-G-T 20180930-G-T DYZ19 ***
22352516-T-G 20190630-T-G DYZ19 ***
22234374-C-T 20072488-C-T DYZ19 ***
22266054-G-A 20104168-G-A FGC76134 DYZ19 ***
22344209-A-G 20182323-A-G DYZ19 ***
22502642-C-G 20340756-C-G DYZ19 ***
58872476-C-T 56718395-G-A ***
58876306-A-T 56714565-T-A ***
13470168-AG-CC 11314492-AG-CC ***
22353012-GG-AA 20191126-GG-AA DYZ19 ***
22421441-GC-TGG 20259555-GC-TGG DYZ19 ***
22263779-G-A 20101893-G-A DYZ19 ***
22273660-G-C 20111774-G-C DYZ19 ***
22311315-C-T 20149429-C-T DYZ19 ***
22235045-C-G 20073159-C-G DYZ19 ***
18403055-G-A 16291175-G-A P6_Gap ***
22421324-T-C 20259438-T-C DYZ19 ***
22421354-T-A 20259468-T-A DYZ19 ***
22421596-G-T 20259710-G-T DYZ19 ***
58846649-G-T 56744222-C-A ***
58913158-T-G 56677713-A-C ***
9942043-A-ATTT 10104434-A-ATTT 28×T***
22234368-TC-GA 20072482-TC-GA DYZ19 ***
22421286-GAAC-TTACA 20259400-GAAC-TTACA DYZ19 ***
22421293-AGAA-GGAG 20259407-AGAA-GGAG DYZ19 ***
22421312-TTAC-CAGT 20259426-TTAC-CAGT DYZ19 ***
22421360-CC-AT 20259474-CC-AT DYZ19 ***
5393293-A-C 5525252-A-C ***
20420959-T-A 18259073-T-A P5_Dst ***
3167154-T-G 3299113-T-G ***
22488496-G-T 20326610-G-T DYZ19 ***
58840431-G-C 56750440-C-G ***
58844027-T-TTCCATTCGATTCCA 56746842-A-AATGGAATCGAATGG ***
22268181-G-A 20106295-G-A DYZ19 ***
22501927-TTTAG-GTGAT 20340041-TTTAG-GTGAT DYZ19 ***
22263702-C-G 20101816-C-G DYZ19 ***
22268207-A-C 20106321-A-C DYZ19 ***
22337250-C-T 20175364-C-T DYZ19 ***
22337286-G-C 20175400-G-C DYZ19 ***
22365813-C-G 20203927-C-G DYZ19 ***
22256973-TTCATGGACTTA-ATCAAGGTCTTG 20095087-TTCATGGACTTA-ATCAAGGTCTTG DYZ19 ***
58838355-A-C 56752516-T-G ***
58840421-G-C 56750450-C-G ***
58840442-C-A 56750429-G-T ***
58823284-TCTCAT-A 56767582-ATGAGA-T ***
58844840-C-A 56746031-G-T ***
58877079-G-C 56713792-C-G ***
13263676-TGCG-AGCT 11108000-TGCG-AGCT ***
13435833-ATACG-GTACA 11280157-ATACG-GTACA ***
13254009-TTTT-A 11098333-TTTT-A ***
13139979-GGAGGGG-CATTGC 10629465-GGAGGGG-CATTGC ***
13142419-GTGTCCT-CA 10631905-GTGTCCT-CA ***
22235133-AGC-TG 20073247-AGC-TG DYZ19 ***
22345997-C-TAG 20184111-C-TAG DYZ19 ***
13129663-TC-CTT 10619149-TC-CTT ***
13140043-GAGTG-ACT 10629529-GAGTG-ACT ***
22237314-CC-AAT 20075428-CC-AAT DYZ19 ***
22421841-T-G 20259955-T-G DYZ19 ***
22488497-T-C 20326611-T-C DYZ19 ***
22273721-G-T 20111835-G-T DYZ19 ***
3902502-TAAAAATATAATACATTCAAATAGAA-T 4034461-TAAAAATATAATACATTCAAATAGAA-T ***
13441433-TG-T 11285757-TG-T 10×G***
14491215-A-AAACAT ***
22342845-ATC-GTT 20180959-ATC-GTT DYZ19 ***
28819269-GGTA-TGGG 26673122-GGTA-TGGG ***
58866446-CCCA-TCCG 56724422-TGGG-CGGA ***
22352931-A-T 20191045-A-T DYZ19 ***
13389874-C-T 11234198-C-T ***
58876306-ATTGC-TTTGT 56714561-GCAAT-ACAAA ***
22268178-T-G 20106292-T-G DYZ19 ***
22234427-T-A 20072541-T-A DYZ19 ***
22421538-G-C 20259652-G-C DYZ19 ***
5107030-A-AT 5238989-A-AT ***
25472004-C-T 23325857-C-T FGC11716 P2_r2 ***
5107036-ACCAT-CCCAC 5238995-ACCAT-CCCAC ***
13473507-GATA-TATG 11317831-GATA-TATG ***
13483218-CT-TG 11327542-CT-TG ***
13488959-GCC-TCG 11333283-GCC-TCG ***
22337261-TCTT-ACTA 20175375-TCTT-ACTA DYZ19 ***
28253491-C-CAAAAA 26107344-C-CAAAAA P1_b4 32×A***
13728164-T-C 11572488-T-C ***
22327478-C-A 20165592-C-A DYZ19 ***
58838545-G-C 56752326-C-G ***
13728174-CGG-TGA 11572498-CGG-TGA ***
22962414-G-GTTTTT 20800528-G-GTTTTT 20×T***
22273725-T-C 20111839-T-C DYZ19 ***
58913068-C-A 56677803-G-T ***
22342390-G-C 20180504-G-C DYZ19 ***
22491770-C-T 20329884-C-T DYZ19 ***
58851955-G-A 56738916-C-T ***
22496169-T-C 20334283-T-C DYZ19 ***
27499360-T-C 25353213-T-C P1_Y2 ***
27499376-C-T 25353229-C-T P1_Y2 ***
58831567-T-C 56759304-A-G ***
22235093-G-GC 20073207-G-GC DYZ19 ***
58912945-GGC-TGT 56677924-GCC-ACA ***
22273654-C-G 20111768-C-G DYZ19 ***
22342557-A-C 20180671-A-C DYZ19 ***
22342558-T-C 20180672-T-C DYZ19 ***
22420848-A-G 20258962-A-G DYZ19 ***
22420891-G-C 20259005-G-C DYZ19 ***
58851915-T-C 56738956-A-G ***
22361379-AGAGTTTTT-TGAGTTTG 20199493-AGAGTTTTT-TGAGTTTG DYZ19 ***
27398709-C-T 25252562-C-T FGC28799 P1_g3 ***
58984206-CATA-TATC 56838059-CATA-TATC ***
9932691-A-G 10095082-A-G ***
58831521-G-T 56759350-C-A ***
13484489-AGTTT-TTTTA 11328813-AGTTT-TTTTA ***
58831547-CATTT-GATGA 56759320-AAATG-TCATC ***
22420840-G-A 20258954-G-A DYZ19 ***
58840473-G-T 56750398-C-A ***
58868288-A-C 56722583-T-G ***
22504674-GTGT-CTGG 20342788-GTGT-CTGG DYZ19 ***
24388090-A-ATC 22241943-A-ATC ***
27862535-T-TGAGA 25716388-T-TGAGA P1_Y2 22×GA***
58831512-CATT-TATG 56759356-AATG-CATA ***
22335978-T-A 20174092-T-A DYZ19 ***
22355187-T-A 20193301-T-A DYZ19 ***
13484485-G-C 11328809-G-C ***
7991279-C-A 8123238-C-A ***
22364601-A-T 20202715-A-T DYZ19 ***
22360595-T-G 20198709-T-G DYZ19 ***
15258492-C-A 13146576-C-A ***
22360592-G-C 20198706-G-C DYZ19 ***
22342724-T-A 20180838-T-A DYZ19 ***
22342583-A-T 20180697-A-T DYZ19 ***
22337441-A-G 20175555-A-G DYZ19 ***
22337437-A-C 20175551-A-C DYZ19 ***
22268302-C-T 20106416-C-T DYZ19 ***
22268301-C-G 20106415-C-G DYZ19 ***
22268297-G-T 20106411-G-T DYZ19 ***
22250305-G-T 20088419-G-T DYZ19 ***
22366930-A-T 20205044-A-T DYZ19 ***
22250271-C-T 20088385-C-T DYZ19 ***
22250265-T-G 20088379-T-G DYZ19 ***
15126702-C-A 13014789-C-A ***
19937298-A-C 17825418-A-C P5_Prx ***
22248431-C-T 20086545-C-T DYZ19 ***
58848681-C-A 56742190-G-T ***
22268336-T-G 20106450-T-G DYZ19 ***
22263795-A-G 20101909-A-G DYZ19 ***
13476019-G-A 11320343-G-A ***
13798576-N-A 11677870-A-. ***
58990057-CGGT-TGGC 56843910-CGGT-TGGC ***
58829353-CGA-TGC 56761516-TCG-GCA ***
22366032-G-A 20204146-G-A DYZ19 ***
10776074-C-CCAATG ***
16905867-T-A 14793987-T-A ***
9700780-C-CAAA 9863171-C-CAAA FGC5285 IR3_Prx 23×A***
22344795-G-A 20182909-G-A DYZ19 ***
22480719-G-T 20318833-G-T DYZ19 ***
22289623-C-A 20127737-C-A DYZ19 ***
9940872-C-A 10103263-C-A ***
58872637-CTTCCATTCCATTCGA-C 56718206-CAATGGAATGGAATCG-C ***
58841093-CTCTATC-TTCCATT 56749772-GATAGAG-AATGGAA ***
22421582-TTTAA-CTTAG 20259696-TTTAA-CTTAG DYZ19 ***
22342573-TA-T 20180687-TA-T DYZ19 ***
22266203-ATC-TTG 20104317-ATC-TTG DYZ19 ***
22231844-AGCT-CACG 20069958-AGCT-CACG DYZ19 ***
13483494-GG-CA 11327818-GG-CA ***
22353019-GT-TC 20191133-GT-TC DYZ19 ***
27869290-T-G 25723143-T-G P1_Y2 ***
58913180-C-G 56677691-G-C ***
58892084-G-T 56698787-C-A ***
10775971-A-C ***
9100129-C-T 9262520-C-T ***
58846314-G-A 56744557-C-T ***
7758720-CTTTT-C 7890679-CTTTT-C 17×T***
58843791-T-A 56747080-A-T ***
58840611-C-A 56750260-G-T ***
58835807-C-T 56755064-G-A ***
22435772-C-T 20273886-C-T DYZ19 ***
22421683-T-A 20259797-T-A DYZ19 ***
22421560-C-A 20259674-C-A DYZ19 ***
28804509-ATATGA-GAATGG 26658362-ATATGA-GAATGG ***
28804503-CA-GG 26658356-CA-GG ***
13379546-C-T 11223870-C-T ***
22292065-G-C 20130179-G-C DYZ19 ***
22421679-C-G 20259793-C-G DYZ19 ***
22421582-T-C 20259696-T-C DYZ19 ***
22360677-C-G 20198791-C-G DYZ19 ***
8119050-C-T 8251009-C-T ***
22342696-T-G 20180810-T-G DYZ19 ***
22337241-G-T 20175355-G-T DYZ19 ***
22335714-A-C 20173828-A-C DYZ19 ***
22335671-G-T 20173785-G-T DYZ19 ***
4995367-T-C 5127326-T-C ***
22335666-T-C 20173780-T-C DYZ19 ***
22300984-C-T 20139098-C-T DYZ19 ***
22268290-C-A 20106404-C-A DYZ19 ***
22481053-G-A 20319167-G-A DYZ19 ***
22251627-T-C 20089741-T-C DYZ19 ***
22251619-A-T 20089733-A-T DYZ19 ***
22251617-A-C 20089731-A-C DYZ19 ***
22251591-A-T 20089705-A-T DYZ19 ***
3046471-C-A 3178430-C-A ***
22234702-A-C 20072816-A-C DYZ19 ***
22231787-G-T 20069901-G-T DYZ19 ***
58852098-G-A 56738773-C-T ***
58913099-G-A 56677772-C-T ***
22504831-G-T 20342945-G-T DYZ19 ***
13484461-T-A 11328785-T-A ***
3274403-C-A 3406362-C-A ***
22435779-G-T 20273893-G-T DYZ19 ***
22491429-G-C 20329543-G-C DYZ19 ***
22366465-TTTT-CTTA 20204579-TTTT-CTTA DYZ19 ***
58997192-CCT-ACG 56851045-CCT-ACG ***
22335732-TAG-GTT 20173846-TAG-GTT DYZ19 ***
22297108-C-CT 20135222-C-CT DYZ19 ***
22268178-TTTG-GTTA 20106292-TTTG-GTTA DYZ19 ***
22263840-CA-TC 20101954-CA-TC DYZ19 ***
22252975-TA-CT 20091089-TA-CT DYZ19 ***
22236528-TA-AC 20074642-TA-AC DYZ19 ***
24435600-TA-T 22289453-TA-T 9×A***
22231783-AAAGGAAA-GATGTAAC 20069897-AAAGGAAA-GATGTAAC DYZ19 ***
13129622-CA-GG 10619108-CA-GG ***
13129615-CT-TG 10619101-CT-TG ***
58820252-TG-AT 56770618-CA-AT ***
13435869-T-TG 11280193-T-TG ***
58852082-T-C 56738789-A-G ***
26153962-G-A 24007815-G-A P1_Y1 15×A***
58852068-C-T 56738803-G-A ***
58848606-G-A 56742265-C-T ***
11672576-C-A ***
58848519-G-A 56742352-C-T ***
58848499-G-A 56742372-C-T ***
58846302-C-G 56744569-G-C ***
10776062-T-C,G ***
58844750-C-G 56746121-G-C ***
58843815-C-A 56747056-G-T ***
58843764-A-C 56747107-T-G ***
58840518-T-G 56750353-A-C ***
58833499-A-G 56757372-T-C ***
28808606-A-C,G 26662459-A-C,G ***
13740850-C-T 11585174-C-T ***
22421000-C-A 20259114-C-A DYZ19 ***
13611988-G-GTTTTTTT 11456312-G-GTTTTTTT 19×T***
9522586-CTGAT-TTGAG 9684977-CTGAT-TTGAG ***
9945416-TCTG-CCTA 10107807-TCTG-CCTA ***
9983930-TT-AC 10146321-TT-AC ***
13199164-C-CAAAA 11043488-C-CAAAA 18×A***
13267597-C-CAAAAAAAAA 11111921-C-CAAAAAAAAA 11×A***
13465305-ACCCC-TCTCA 11309629-ACCCC-TCTCA ***
13465322-TT-CC 11309646-TT-CC ***
13469487-AA-GT 11313811-AA-GT ***
13478256-CGA-TGC 11322580-CGA-TGC ***
13488556-GGCGCGTT-AGCGCGTG 11332880-GGCGCGTT-AGCGCGTG ***
13489569-GG-CA 11333893-GG-CA ***
13661297-A-AATGGG 11505621-A-AATGGG ***
9403521-G-GTTTTTTT 9565912-G-GTTTTTTT 21×T***
13847209-A-AAATGGAATGG 11726503-A-AAATGGAATGG 4×AATGG***
13940857-A-AAGAGAG 11820151-A-AAGAGAG 18×AG***
26365074-G-A 24218927-G-A P1_Y1 ***
15733879-C-CAAAA 13621999-C-CAAAA 25×A***
17802166-T-TAAAAA 15690286-T-TAAAAA 30×A***
18035665-C-CTTTTT 15923785-C-CTTTTT 30×T***
18804474-A-AGAG 16692594-A-AGAG 26×AG***
19006136-C-CAAAAAA 16894256-C-CAAAAAA 21×A***
22344763-T-A 20182877-T-A DYZ19 ***
20023980-A-AGATG 17912100-A-AGATG P5_Prx ***
20522238-ATA-TTG 18360352-ATA-TTG P5_Dst ***
20522538-CA-GG 18360652-CA-GG P5_Dst ***
9522577-GAC-CAA 9684968-GAC-CAA ***
9342737-CA-AG 9505128-CA-AG ***
21409460-C-CAAAAAA 19247574-C-CAAAAAA 30×A***
58844948-T-C 56745923-A-G ***
22499068-G-T 20337182-G-T DYZ19 ***
22502012-G-A 20340126-G-A DYZ19 ***
22504105-G-T 20342219-G-T DYZ19 ***
24487402-G-C 22341255-G-C ***
26507832-G-A 24361685-G-A P1_Y1 ***
26721883-G-T 24575736-G-T FGC48695 P1_g2 ***
28006408-C-A 25860261-C-A P1_Y2 ***
28237966-T-G 26091819-T-G P1_b4 ***
58831558-A-T 56759313-T-A ***
58840426-A-G 56750445-T-C ***
58840427-G-T 56750444-C-A ***
58843642-G-T 56747229-C-A ***
58868572-G-C 56722299-C-G ***
8826708-CAG-AAA 8958667-CAG-AAA ***
58876310-C-T 56714561-G-A ***
58893211-T-C 56697660-A-G ***
58898565-A-G 56692306-T-C ***
58910818-A-C 56680053-T-G ***
58911185-A-C 56679686-T-G ***
58913189-A-T 56677682-T-A ***
13479881-TTCT-CCCC 11324205-TTCT-CCCC ***
13489012-AT-GC 11333336-AT-GC ***
3544894-G-GA 3676853-G-GA ***
3628709-G-GAA 3760668-G-GAA 26×A***
6089764-G-GTTTTTTTTTT 6221723-G-GTTTTTTTTTT 31×T***
6858592-C-CTTTT 6990551-C-CTTTT 25×T***
20522562-GTTTT-TTTCC 18360676-GTTTT-TTTCC P5_Dst ***
22227893-AC-TA 20066007-AC-TA DYZ19 ***
14258440-C-T 12137734-C-T S613 ***
58895086-C-A 56695785-G-T FGC43851 FGC78598 ***
2724179-AT-A 2856138-AT-A 10×T***
22342722-CCT-TCA 20180836-CCT-TCA DYZ19 ***
22342669-GATGAGGC-AATTAAGT 20180783-GATGAGGC-AATTAAGT DYZ19 ***
22268537-TTTAC-T 20106651-TTTAC-T DYZ19 ***
22227923-CT-GG 20066037-CT-GG DYZ19 ***
22127975-C-CTTTTTT 19966089-C-CTTTTTT 20×T***
13484476-GAGCA-AAGCC 11328800-GAGCA-AAGCC ***
13140074-GAGTGCGTGTG-CACTCCATTTT 10629560-GAGTGCGTGTG-CACTCCATTTT ***
22229322-A-AG 20067436-A-AG DYZ19 ***
58917658-N-G 56673213-N-C ***
58912635-G-C 56678236-C-G ***
58889965-G-A 56700906-C-T ***
22361210-CGAA-AGAC 20199324-CGAA-AGAC DYZ19 ***
58846680-A-C 56744191-T-G ***
10747023-C-T ***
14774283-TC-T 12662352-TC-T ***
58843740-A-C 56747131-T-G ***
22504103-G-A 20342217-G-A DYZ19 ***
22501967-G-T 20340081-G-T DYZ19 ***
7131901-G-A 7263860-G-A ***
22361107-A-G 20199221-A-G DYZ19 ***
22357635-G-T 20195749-G-T DYZ19 ***
22342651-T-G 20180765-T-G DYZ19 ***
22342639-T-A 20180753-T-A DYZ19 ***
22335693-T-G 20173807-T-G DYZ19 ***
3446607-CAAA-C 3578566-CAAA-C 25×A***
13447111-C-G 11291435-C-G ***
22234944-AG-TA 20073058-AG-TA DYZ19 ***
27035480-CTT-C 24889333-CTT-C P1_r4 16×T***
22265972-GTGTCC-TTGCAT 20104086-GTGTCC-TTGCAT DYZ19 ***
22273539-CTT-C 20111653-CTT-C DYZ19 ***
22289469-TTTA-CTT 20127583-TTTA-CTT DYZ19 ***
22289476-CTG-TTT 20127590-CTG-TTT DYZ19 ***
22420853-TAGT-GAGA 20258967-TAGT-GAGA DYZ19 ***
22420862-CATTCT-ACTTCA 20258976-CATTCT-ACTTCA DYZ19 ***
22420876-CAAAA-AGGAG 20258990-CAAAA-AGGAG DYZ19 ***
22504694-TAAACGT-CAAAGGC 20342808-TAAACGT-CAAAGGC DYZ19 ***
23389531-C-CTTTTTTT 21227645-C-CTTTTTTT 18×T***
25080053-C-CAA 22933906-C-CAA g1 20×A***
25675611-AG-TC 23529464-AG-TC P1_b3 ***
25709386-G-GTTTTTTTT 23563239-G-GTTTTTTTT P1_b3 31×T***
27862535-T-AGAGA 25716388-T-AGAGA P1_Y2 22×GA***
22481441-GCAGT-CCAGA 20319555-GCAGT-CCAGA DYZ19 ***
28819330-AGATTGGATTGGAG-CAAATGGTTTTGAA 26673183-AGATTGGATTGGAG-CAAATGGTTTTGAA ***
58840789-TCCCTTTGTTTCCATTCTCTTCGATTCCATTTCTTTATATTCCATG-T 56750034-TGGCATGGAATATAAAGAAATGGAATCGAAGAGAATGGAAACAAAG-T ***
58893212-TTCCC-CTCAG 56697655-GGGAA-CTGAG ***
22344769-T-A 20182883-T-A DYZ19 ***
58859614-A-G 56731257-T-C ***
13203970-C-T 11048294-C-T ***
27151329-GTA-TTT 25005182-GTA-TTT P1_g3 ***
13483325-T-G 11327649-T-G A13791 ***
25592898-CTC-ATA 23446751-CTC-ATA P1_gr1 ***
13856402-T-A,G 11735696-T-A,G ***
13139239-TCATTC-CCATTC,T 10628725-TCATTC-CCATTC,T 10×CATTC***
13805365-A-AGGATT,T 11684659-A-AGGATT,T ***
56867491-A-AT 11×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
FTY371
FTY303
FTY10
FTY284
FTY219
FTY324
FTY327
FTY394
DYS538
FTY220
FTY254
FTY19
FTY4
DYS577
FTY24
FTY346
FTY160
FTY62
FTY400
FTY114
FTY246
FTY26
FTY368
FTY173
FTY209
FTY337
FTY81
FTY387
FTY361
FTY330
FTY65
FTY168
FTY171
FTY136
FTY53
FTY40
FTY386
FTY100
FTY152
FTY55
FTY297
FTY370
FTY103
FTY64
FTY174
FTY313
FTY362
FTY342
FTY161
FTY374
FTY316
FTY101
FTY204
DYS477
FTY192
DYS502
FTY341
DYS493
FTY1
FTY227
DYS499
FTY391
FTY353
FTY332
FTY163
DYS483
FTY172
FTY180
DYS581
FTY179
FTY188
FTY369
FTY70
FTY63
DYS508
FTY347
FTY83
FTY277
FTY276
FTY195
FTY109
FTY356
FTY215
FTY105
FTY123
FTY242
FTY214
FTY132
FTY262
FTY333
FTY208
DYF398B
FTY43
FTY166
FTY13
FTY11
DYS584
DYS608
FTY95
FTY151
FTY388
FTY256
DYS580
FTY234
FTY268
FTY139
FTY27
FTY75
DYS512
FTY329
FTY320
FTY7
FTY247
FTY211
DYS474
FTY39
FTY376
FTY37
FTY373
DYS475
FTY138
FTY288
FTY264
FTY93
FTY380
FTY18
FTY115
DYS569
FTY390
FTY46
FTY243
FTY322
FTY281
FTY153
FTY181
FTY184
FTY359
FTY121
FTY74
FTY279
DYS530
FTY45
DYS573
DYS542
FTY36
FTY304
FTY203
FTY291
FTY142
FTY191
FTY183
FTY141
FTY299
FTY193
FTY124
FTY16
FTY236
FTY185
FTY378
FTY225
FTY397
FTY3
FTY67
FTY182
FTY334
DYS623
FTY348
FTY357
FTY275
FTY306
FTY383
FTY253
FTY285
DYS645
FTY17
FTY85
DYS598
FTY375
FTY325
FTY12
FTY365
FTY35
FTY237
FTY238
FTY305
FTY56
FTY129
FTY352
FTY292
FTY154
DYS539
FTY301
FTY366
FTY231
DYS618
FTY216
FTY82
FTY393
FTY155
FTY68
FTY32
FTY265
FTY300
FTY143
FTY201
FTY199
FTY86
FTY98
FTY144
DYS541
DYS507
FTY20
FTY116
FTY308
FTY177
FTY89
FTY158
FTY22
FTY84
FTY186
FTY396
FTY91
FTY29
FTY78
FTY229
FTY260
FTY250
FTY364
DYS476
FTY221
FTY57
FTY377
FTY384
DYS466
FTY363
FTY137
FTY69
FTY72
FTY251
FTY2
FTY217
FTY257
FTY120
FTY25
FTY252
FTY33
FTY42
FTY54
FTY372
DYS480
FTY176
FTY76
FTY66
FTY197
FTY385
FTY270
FTY298
FTY198
FTY117
DYS544
FTY159
FTY232
FTY156
FTY343
FTY296
FTY311
FTY344
FTY178
FTY367
FTY73
FTY112
FTY295
DYS616
FTY338
FTY196
FTY157
FTY162
DYS551
FTY148
FTY94
FTY52
FTY131
FTY9
FTY194
FTY8
FTY318
FTY317
FTY99
FTY289
FTY169
FTY51
FTY345
FTY398
FTY111
FTY273
FTY382
FTY47
FTY30
FTY147
DYS615
FTY302
FTY354
FTY326
FTY88
FTY248
FTY267
FTY170
FTY60
DYS453
FTY249
FTY167
DYS624
FTY134
FTY235
FTY145
FTY14
FTY80
FTY50
DYS514
FTY340
DYS585
DYS516
FTY293
FTY207
FTY278
FTY210
DYS523
FTY269
FTY530
FTY1156
FTY1070
FTY906
FTY1004
FTY331
FTY31
FTY226
FTY335
DYS583
FTY339
FTY113
FTY280
FTY255
FTY59
DYS620
FTY349
FTY130
FTY119
DYF398A
FTY58
FTY127
FTY321
FTY92
FTY392
DYF392
FTY290
FTY312
FTY135
FTY150
FTY294
FTY244
FTY48
FTY282
DYS489
FTY272
FTY239
FTY258
FTY49
DYS574
FTY41
FTY905
FTY1103
FTY502
FTY743
FTY443
FTY670
FTY883
DYS631
FTY1042
FTY510
DYS389B
FTY512
FTY837
DYS642
FTY407
FTY935
FTY563
FTY1016
FTY1091
FTY1049
FTY1155
DYS602
FTY587
FTY635
FTY904
DYS543
FTY1148
FTY861
FTY742
FTY433
FTY1039
FTY71
FTY259
FTY108
FTY336
FTY44
FTY233
FTY274
FTY34
FTY942
FTY1068
FTY945
FTY1051
FTY658
FTY625
FTY800
FTY818
FTY971
FTY509
FTY1025
FTY835
FTY984
DYS637
FTY832
FTY689
FTY998
FTY520
FTY445
FTY809
FTY428
FTY562
FTY897
FTY1064
FTY1088
FTY1052
DYF405
FTY310
FTY189
DYS488
FTY283
FTY28
FTY578
DYS484
FTY858
FTY596
FTY915
FTY446
FTY452
FTY1006
FTY612
FTY507
FTY614
FTY824
FTY1055
FTY690
FTY2318
FTY981
FTY946
FTY1040
DYS718
FTY15
FTY2025
DYS685u1
DYS596u5
FTY1511
FTY769
FTY923
FTY1167
FTY415
FTY505
FTY241
FTY2263
FTY517
FTY2180
FTY775
DYS567
FTY444
FTY691
FTY1120
FTY223
DYF393u3
FTY1850
FTY645
FTY696
FTY1166
FTY991
FTY912
DYS551u4
FTY447
DYS518u3
FTY875
DYS536u1
FTY585
FTY896
FTY731
FTY401
FTY2011
FTY665
FTY814
FTY2050
DYS626u3
FTY750
FTY471
FTY985
FTY589
FTY420
FTY921
FTY457
FTY657
FTY1110
FTY485
FTY315
FTY1852
FTY1107
FTY489
FTY522
FTY654
FTY110
FTY881
DYS470
FTY534
FTY1101
FTY1933
FTY936
FTY772
FTY1047
FTY2351
FTY680
FTY2254
FTY1030
FTY2083
FTY287
FTY797
FTY2366
FTY951
FTY774
FTY1116
DYS621
FTY885
FTY1012
DYF394u1
FTY888
FTY648
FTY725
FTY643
FTY927
FTY1022
DYS559
FTY933
FTY633
FTY900
FTY1848
FTY478
FTY533
FTY467
FTY1900
FTY421
DYS612u5
DYS595
FTY668
FTY1028
DYS579
FTY646
FTY1026
FTY801
FTY432
FTY2301
FTY466
FTY531
FTY1083
FTY997
FTY1114
FTY830
FTY655
FTY910
FTY1143
FTY572
DYS506
DYS558u2
FTY1127
FTY712
FTY634
FTY499
FTY1094
FTY724
FTY535
FTY552
FTY430
FTY588
DYS609
FTY961
FTY813
FTY656
FTY839
FTY882
FTY789
FTY459
FTY1037
FTY435
FTY1157
FTY1546
FTY2242
FTY720
DYS614u10
FTY887
FTY473
FTY816
FTY1060
FTY472
FTY943
FTY1482
FTY565
DYS629
FTY891
FTY438
DYS582
FTY468
FTY649
FTY606
FTY792
FTY1087
FTY895
DYS614u3
FTY574
FTY1556
FTY560
FTY694
FTY1097
DYS518u6
FTY876
FTY2443
FTY990
FTY934
FTY465
FTY1046
FTY1312
FTY751
FTY1915
FTY678
FTY419
FTY958
FTY456
DYS592u1
FTY1172
FTY416
FTY650
FTY808
FTY1542
DYS721u1
FTY746
FTY2233
FTY892
FTY845
FTY1034
FTY498
DYF382u1
FTY637
DYS588
FTY947
DYS543u3
FTY644
DYS703
DYS649
FTY212
FTY781
FTY1106
FTY592
FTY848
FTY940
FTY903
FTY1081
FTY952
DYS706u2
FTY1084
FTY700
FTY482
DYS625u7
FTY960
FTY586
FTY1330
FTY1119
FTY1762
FTY1010
FTY417
FTY716
DYS627u3
FTY1942
FTY1067
FTY841
FTY1031
FTY1082
FTY1023
FTY475
FTY222
FTY962
FTY423
FTY664
DYS517u1
FTY1076
FTY1557
FTY1154
DYS681
FTY1002
DYS706u1
FTY1174
FTY986
FTY651
FTY886
FTY1078
DYS546u4
FTY1092
FTY2471
FTY1111
FTY461
FTY323
FTY1013
FTY506
FTY550
FTY767
FTY721
DYS548
FTY559
DYS705
FTY640
FTY613
FTY402
FTY2426
FTY755
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
McClure1324141111-141212121316291710-1011112515182915-16-16-17111119-231514201737-40121211915-1681010810101323-231710121215813222013121113111212123515916122426191211121212913111011113112142413101021151612241712152412241810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 995121056196576134707683210
Kit: PY5HU*16000000100000008300000
Kit: 99512959727778137007711868
Kit: 995121475762192600188237200
Used in age calculations16000000100000008300000
Counts of SNPs10
Variant counts last updated 2022-09-21 03:04:57.

* BED data not available. Using default values.


Big Tree Main Page