Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > FGC5494 > FGC5561 > Z16503 > Z16504 > Z16502 > Z17653 > Y17660 > Y17662

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
B10756
FTDNA
B10756
BigY2
B10756
10537-T-A +
13488828-TGA-T 11333152-TGA-T +
22355001-CT-C 20193115-CT-C DYZ19 +
22354997-G-GC 20193111-G-GC DYZ19 +
22365916-C-A 20204030-C-A DYZ19 +
10851173-C-T +
22250487-G-GAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCACATAAAGGTGTTATGTCCAC 20088601-G-GAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCACATAAAGGTGTTATGTCCAC DYZ19 +
3817326-CT-C 3949285-CT-C +**
22234339-TAAGGTCTGCAGCTTCATTCTTGACGTGATCAAGACCATGAATCTGCCAGAAAGAAGA-T 20072453-TAAGGTCTGCAGCTTCATTCTTGACGTGATCAAGACCATGAATCTGCCAGAAAGAAGA-T DYZ19 +
22365903-C-G 20204017-C-G DYZ19 +
3683165-G-T 3815124-G-T +**
13480396-A-T 11324720-A-T +
22229416-GATGGAACAAACTCTGGACATAAAACCTTTAAGTGCTGTAACGCTCACCACTAAGGTCTGCGGCTTCATTCTTGAAGAGAACAAGACCATGAACCTGCCAGAAT-G 20067530-GATGGAACAAACTCTGGACATAAAACCTTTAAGTGCTGTAACGCTCACCACTAAGGTCTGCGGCTTCATTCTTGAAGAGAACAAGACCATGAACCTGCCAGAAT-G DYZ19 +
22229392-AAGGAAGAAACTCTAGACACATT-A 20067506-AAGGAAGAAACTCTAGACACATT-A DYZ19 +
13474576-C-T 11318900-C-T +
10781414-C-A +**
22357675-T-A 20195789-T-A DYZ19 +
22365947-A-G 20204061-A-G DYZ19 +
10787299-T-G +
23065449-C-T 20903563-C-T Y+
2888870-C-CAAA 3020829-C-CAAA 32×A+
4770399-G-T 4902358-G-T +**
13726727-T-C 11571051-T-C +
22365939-C-T 20204053-C-T DYZ19 +
58854698-A-T 56736173-T-A +
10022081-C-A 10184472-C-A Y+**
4672384-C-A 4804343-C-A +**
58841106-G-A 56749765-C-T +
4569339-C-A 4701298-C-A +**
13726739-C-T 11571063-C-T +
4279782-T-C 4411741-T-C +**
22365996-G-A 20204110-G-A DYZ19 +
22365985-C-T 20204099-C-T DYZ19 +
22365978-G-C 20204092-G-C DYZ19 +
3331600-C-A 3463559-C-A +**
10787346-A-G +
5159600-G-A 5291559-G-A +**
11033968-T-C +
14668812-C-A 12556878-C-A Y+**
22435741-A-C 20273855-A-C DYZ19 +
22435743-C-T 20273857-C-T DYZ19 +
22435744-T-G 20273858-T-G DYZ19 +
22435754-G-C 20273868-G-C DYZ19 +
22435755-T-G 20273869-T-G DYZ19 +
17319880-G-GA 15208000-G-GA 16×AAGA+
18003090-C-A 15891210-C-A P7_Gap Y+
17319879-G-GAAA 15207999-G-GAAA +
11033955-AAACTC-A +
56834580-C-CGCCAT +
12542-G-T +
11033973-T-A +
10663886-C-T +
17894-T-C +
17914-A-T +
10787347-C-T +
13488826-C-CAA 11333150-C-CAA +
56850837-C-G +
10760430-C-T +
21153414-G-T 18991528-G-T Y+
10533-T-G +
10861156-C-A +**
10943640-C-A +**
10949561-T-C +**
18549435-T-TAC 16437555-T-TAC +
13488809-A-T 11333133-A-T +
10976107-G-A +**
10976123-T-C +**
28802761-A-G 26656614-A-G +
28802758-A-G 26656611-A-G +
28802754-GCA-G 26656607-GCA-G +
11010221-C-A +**
4976977-G-T 5108936-G-T +**
13473921-T-C 11318245-T-C +
5207220-C-T 5339179-C-T +**
56850864-T-C +
26794331-G-C 24648184-G-C P1_g2 +
11033975-C-A +
7920432-T-C 8052391-T-C Y46618 YY+++
59018248-G-A 56872101-G-A +
13270830-G-T 11115154-G-T +
22252155-G-C 20090269-G-C BY12362 DYZ19 +***
5922475-G-A 6054434-G-A +**
6006243-A-G 6138202-A-G +**
6062046-T-C 6194005-T-C +**
13221977-A-G 11066301-A-G +
22205204-C-A 20043318-C-A Y+**
22435750-C-CCT 20273864-C-CCT DYZ19 +
10663895-T-TAGA +
10663888-A-G +
56736218-G-T +
17649541-A-G 15537661-A-G A7576 YY+++
56756749-G-A +
7076644-C-A 7208603-C-A YY+
58993309-C-T 56847162-C-T +
13728176-G-A 11572500-G-A +
23400083-G-T 21238197-G-T Y+**
56847199-TG-T +
58827223-G-T 56763648-C-A +
56850817-A-G +
56850822-C-A +
56850905-C-G +
10527-G-A +
10536-A-C +
22481703-G-A 20319817-G-A DYZ19 +
22360029-A-C 20198143-A-C DYZ19 +
26723606-G-T 24577459-G-T P1_g2 +
10663882-C-G +
21153460-C-T 18991574-C-T Y+**
24046215-A-C 21900068-A-C Y+
23078-G-T FGC82936 +
13474567-C-T 11318891-C-T +
23115-A-G +
21679007-G-T 19517121-G-T Y+**
21153466-T-C 18991580-T-C Y+**
23067-A-G +
23100-G-A +
7341719-A-G 7473678-A-G Y*
13478369-C-G 11322693-C-G *
13478399-T-G 11322723-T-G *
13478425-G-C 11322749-G-C *
13474364-A-T 11318688-A-T *
8550844-TAAAAA-T,TAAAA 8682803-TAAAAA-T,TAAAA 17×A*
13479120-A-C 11323444-A-C *
8514234-C-A 8646193-C-A YY*
28802745-ATTCAAATT-A 26656598-ATTCAAATT-A *
8540691-C-A 8672650-C-A YY*
8600009-C-CT,T 8731968-C-CT,T 13×T*
8499461-C-A 8631420-C-A YY*
13470490-T-G 11314814-T-G *
13470506-C-A 11314830-C-A *
6818761-G-T 6950720-G-T YY*
7285908-C-A 7417867-C-A YY*
6647099-C-A 6779058-C-A YY*
8441331-C-A 8573290-C-A YY*
8431666-C-G 8563625-C-G YY*
8563745-C-CTTTT 8695704-C-CTTTT 21×T*
8695040-C-A 8826999-C-A YY*
8675216-C-A 8807175-C-A YY*
17332750-C-CA,CA 15220870-C-CA,CA 22×A*
7282722-C-A 7414681-C-A YY*
6402240-CGGTGTCGT-C 6534199-CGGTGTCGT-C *
6402249-AAAATACCAATGTATATGTTATATTCGTACGTGCCGTAAAATACCGACGTATATGTTATATTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAATCGTCG-A 6534208-AAAATACCAATGTATATGTTATATTCGTACGTGCCGTAAAATACCGACGTATATGTTATATTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAATCGTCG-A *
22509138-G-A 20347252-G-A DYZ19 *
22509143-G-T 20347257-G-T BY38421 DYZ19 *
56832762-G-T,T *
22361036-TG-T 20199150-TG-T DYZ19 *
13695077-GAATGGAATGTAATCA-G 11539401-GAATGGAATGTAATCA-G *
11033918-T-G,G *
13489869-T-C 11334193-T-C *
7162060-C-A 7294019-C-A YY*
7137500-C-A 7269459-C-A YY*
7078214-G-T 7210173-G-T YY*
13484426-A-T 11328750-A-T *
7076649-ATTAGCT-A 7208608-ATTAGCT-A *
8876993-G-T 9008952-G-T Y*
8806359-C-A 8938318-C-A YY*
13470646-G-A 11314970-G-A *
13489825-G-A 11334149-G-A *
8350662-C-A 8482621-C-A YY*
13740242-G-C 11584566-G-C *
7503851-AACACAC-A 7635810-AACACAC-A IR1_L 20×AC*
2880606-A-G 3012565-A-G YY*
5710452-T-C 5842411-T-C *
5577139-G-A 5709098-G-A *
2824718-TCACCCC-T 2956677-TCACCCC-T *
2862554-C-A 2994513-C-A YY*
7641729-C-A 7773688-C-A YY*
5443496-C-A 5575455-C-A *
5335492-T-TAAAAA 5467451-T-TAAAAA 11×A*
5073586-T-TATATATATATATACACTGA 5205545-T-TATATATATATATACACTGA *
2873978-C-A 3005937-C-A YY*
2873989-CT-C 3005948-CT-C *
3267588-C-A 3399547-C-A *
7701601-C-A 7833560-C-A YY*
3865856-C-A 3997815-C-A *
7314796-A-AT 7446755-A-AT 9×T*
4472604-C-T 4604563-C-T *
4138632-G-T 4270591-G-T *
13448292-C-A 11292616-C-A *
3994872-G-T 4126831-G-T *
4069885-TG-T 4201844-TG-T *
7591020-C-A 7722979-C-A YY*
7338415-A-T 7470374-A-T Y*
7451538-T-C 7583497-T-C IR1_L *
5782122-C-A 5914081-C-A *
7308446-A-G 7440405-A-G YY*
7402686-C-A 7534645-C-A YY*
20163457-TGTGTCCAGAGTTTCTTCCTTGTGGCAGGTTCATGGTCTTGCTCACTTC- DYZ19 *
56707207-A-T *
56707208-C-T *
8284030-A-T 8415989-A-T YY*
6332013-C-A 6463972-C-A IR3_Dst *
8119489-G-GT,GTTT 8251448-G-GT,GTTT 14×T*
13470028-A-T 11314352-A-T *
21464901-C-A 19303015-C-A YY*
7304266-C-A 7436225-C-A Y*
13478418-G-T 11322742-G-T *
13331935-G-A 11176259-G-A *
20163507-AGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTAT- DYZ19 *
2807024-TTA-T,TTATA 2938983-TTA-T,TTATA 20×TA*
24870887-TTCTC-T,TTC 22724740-TTCTC-T,TTC IR1_R 23×TC*
2767627-ATACTCATTTCTG-A 2899586-ATACTCATTTCTG-A *
2778341-C-A 2910300-C-A YY*
7284159-T-C 7416118-T-C YY*
5910626-C-A 6042585-C-A *
7897421-G-T 8029380-G-T Y*
7733820-T-A 7865779-T-A YY*
7708699-C-A 7840658-C-A YY*
7707737-T-C 7839696-T-C YY*
2805529-CAA-C,CAAA 2937488-CAA-C,CAAA 22×A*
2783675-T-A 2915634-T-A YY*
13465020-A-T 11309344-A-T *
13462571-A-T 11306895-A-T *
13458703-C-G 11303027-C-G *
27370827-G-GA 25224680-G-GA P1_g3 11×A*
13480851-G-T 11325175-G-T *
16279645-C-A 14167765-C-A YY*
13489179-G-C 11333503-G-C *
6815735-C-A 6947694-C-A YY*
13461969-G-A 11306293-G-A *
13489172-T-C 11333496-T-C *
13315926-C-A 11160250-C-A *
22364496-G-T 20202610-G-T DYZ19 *
13489195-C-T 11333519-C-T *
13470600-G-T 11314924-G-T *
13470623-C-T 11314947-C-T *
22658097-C-A 20496211-C-A YY*
13470527-G-C 11314851-G-C *
13458746-C-A 11303070-C-A *
6509766-C-A 6641725-C-A *
56831352-G-T *
21254054-C-A 19092168-C-A BY191667 YY*
23817821-A-G 21655935-A-G Y*
19543635-C-A 17431755-C-A YY*
22475280-G-T 20313394-G-T DYZ19 *
14743430-C-A 12631499-C-A Y*
17278273-CGAAAGAAAGAAAGAAA-C,CGAAA 15166393-CGAAAGAAAGAAAGAAA-C,CGAAA 16×GAAA*
22867135-C-A 20705249-C-A YY*
13478433-G-C 11322757-G-C *
13701869-G-C 11546193-G-C *
13478421-G-T 11322745-G-T *
13726619-G-C 11570943-G-C *
13730083-C-G 11574407-C-G *
13484371-C-T 11328695-C-T *
16908451-TAAA-T,TA 14796571-TAAA-T,TA 21×A*
21476828-C-A 19314942-C-A YY*
13469845-T-C 11314169-T-C *
10657397-T-A *
13465083-C-A 11309407-C-A *
13349844-C-A 11194168-C-A *
8506820-G-GA 8638779-G-GA 9×A*
17085979-C-A 14974099-C-A YY*
19042764-C-A 16930884-C-A Y*
10057322-T-C 10219713-T-C *
13483286-A-T 11327610-A-T *
13504947-G-A 11349271-G-A *
19721467-C-A 17609587-C-A P5_Prx *
19770058-C-A 17658178-C-A P5_Prx *
13480291-C-A 11324615-C-A *
28806498-G-T 26660351-G-T *
16374686-GAAA-G 14262806-GAAA-G 19×A*
16922075-C-A 14810195-C-A YY*
5927019-G-T 6058978-G-T *
56685651-G-C *
13458729-T-C 11303053-T-C *
13708879-C-G 11553203-C-G *
4887952-C-A 5019911-C-A *
8661332-C-A 8793291-C-A Y*
17343801-C-A 15231921-C-A YY*
20554592-G-T 18392706-G-T P5_Dst *
24378372-C-A 22232225-C-A Y*
13489151-T-A 11333475-T-A *
21730548-ATTT-A,ATT 19568662-ATTT-A,ATT 23×T*
21821695-C-A 19659809-C-A YY*
3725950-C-A 3857909-C-A *
4473364-G-T 4605323-G-T *
14247918-C-A 12127212-C-A YY*
28819071-T-A 26672924-T-A *
22229379-A-T 20067493-A-T DYZ19 *
16874674-C-A 14762794-C-A YY*
7567753-C-CT,CT 7699712-C-CT,CT 25×T*
22228431-A-C 20066545-A-C DYZ19 *
13476712-A-T 11321036-A-T *
13478434-G-T 11322758-G-T *
13745432-A-C 11589756-A-C *
13483274-C-T 11327598-C-T *
13489742-T-G 11334066-T-G *
28805782-G-T 26659635-G-T *
9177929-TTGTG-T,TTG 9340320-TTGTG-T,TTG 15×TG*
13465072-G-C 11309396-G-C *
19125694-CA-C,CAA 17013814-CA-C,CAA 24×A*
11550439-T- 4×ATGGA*
10693989-T-TC *
13730073-T-C 11574397-T-C *
13730084-A-G 11574408-A-G *
16921951-C-A 14810071-C-A YY*
22364521-G-C 20202635-G-C DYZ19 *
13469867-G-T 11314191-G-T *
20307446-G- DYZ19 *
22486883-G-A 20324997-G-A DYZ19 *
13470581-G-A 11314905-G-A *
13470641-C-A 11314965-C-A *
11322588-A- *
24553246-CA-C 22407099-CA-C P3_t2 11×A*
13470464-C-A 11314788-C-A *
56685591-G-C *
13469672-C-G 11313996-C-G *
13462577-G-A 11306901-G-A *
13478368-C-A 11322692-C-A *
13493852-G-GTTATTTTATTTTATT 11338176-G-GTTATTTTATTTTATT 7×TTATT*
22509122-T-C 20347236-T-C DYZ19 *
13469997-G-A 11314321-G-A *
13730561-A-G 11574885-A-G *
13469865-T-G 11314189-T-G *
22357426-T-A 20195540-T-A DYZ19 *
13469883-C-G 11314207-C-G *
13468344-T-A 11312668-T-A *
13463251-C-A 11307575-C-A *
13689740-C-G 11534064-C-G *
20473101-ATGG-A 18311215-ATGG-A P5_Dst 6×TGG*
13694625-T-A 11538949-T-A *
13469995-C-G 11314319-C-G *
13478311-C-T 11322635-C-T *
13473869-T-G 11318193-T-G *
23759113-TAA-T,TA 21597227-TAA-T,TA 24×A*
13479440-A-G 11323764-A-G BY86034 *
5852849-G-GA 5984808-G-GA 9×A*
9847289-ATTTTTTTT-A 10009680-ATTTTTTTT-A 28×T*
13477294-C-T 11321618-C-T *
13479428-G-T 11323752-G-T *
13479459-T-G 11323783-T-G *
13469839-G-A 11314163-G-A *
10693991-A-ATTCCATTCCATTCCATTCC *
13469817-C-T 11314141-C-T *
13449960-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC *
13697389-T-TATGGAATGGAATGGAATGGAATGGAATGGA 11541713-T-TATGGAATGGAATGGAATGGAATGGAATGGA *
22505752-G-A 20343866-G-A DYZ19 *
13693694-GAATGA-G 11538018-GAATGA-G *
13294697-C-T 11139021-C-T *
3286731-G-T 3418690-G-T *
13487918-C-T 11332242-C-T *
13448060-C-CACACCATTCCACT 11292384-C-CACACCATTCCACT *
13688200-T-TGGAAA 11532524-T-TGGAAA *
13448063-T-TC 11292387-T-TC *
13448061-G-GCA 11292385-G-GCA *
22298456-G-GAGTGTTACAGCAGTTAAAGGTATTGTGTCCAGAGTTTGTTTCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTACCTTCCAGAATGAAGCTGCAGACATTTAAGGTA 20136570-G-GAGTGTTACAGCAGTTAAAGGTATTGTGTCCAGAGTTTGTTTCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTACCTTCCAGAATGAAGCTGCAGACATTTAAGGTA DYZ19 *
21714801-ATTGTAAACACACACGAGG-A 19552915-ATTGTAAACACACACGAGG-A *
9048553-C-A 9210944-C-A Y*
13453454-T-TATTCC,TATTCCATTCC 11297778-T-TATTCC,TATTCCATTCC 11×ATTCC*
9333771-C-T 9496162-C-T Y*
22244917-C-A 20083031-C-A DYZ19 *
21294968-C-A 19133082-C-A YY*
21407978-A-T 19246092-A-T YY*
21436071-C-A 19274185-C-A YY*
21617788-A-AAAG 19455902-A-AAAG 5×AAAG*
21953032-C-A 19791146-C-A YY*
21963603-A-G 19801717-A-G YY*
21986998-C-A 19825112-C-A YY*
22034544-C-A 19872658-C-A YY*
22053663-C-A 19891777-C-A YY*
22185855-CT-C,CTTT 20023969-CT-C,CTTT 25×T*
22234260-CAGAA-C 20072374-CAGAA-C DYZ19 *
22234269-GAAATTCTGGACACATCCGAATGAACAAACTCTGGACATAACACCTTTAA-G 20072383-GAAATTCTGGACACATCCGAATGAACAAACTCTGGACATAACACCTTTAA-G DYZ19 *
22234320-TGCTGTAACACTCTATC-T 20072434-TGCTGTAACACTCTATC-T DYZ19 *
22237297-A-AC,AG 20075411-A-AC,AG DYZ19 *
22251261-T-G 20089375-T-G DYZ19 *
21223249-G-A 19061363-G-A YY*
22488856-GTT-G 20326970-GTT-G DYZ19 *
22655459-C-A 20493573-C-A YY*
22634973-A-G 20473087-A-G Y*
22561567-C-A 20399681-C-A YY*
22490764-G-T 20328878-G-T DYZ19 *
22490756-A-G 20328870-A-G DYZ19 *
22490753-G-A 20328867-G-A DYZ19 *
22488851-C-CAG 20326965-C-CAG DYZ19 *
22251641-TC-T 20089755-TC-T DYZ19 *
22361384-T-A 20199498-T-A DYZ19 *
20199153-CTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAAACGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCACAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGT- DYZ19 *
22326138-C-T 20164252-C-T DYZ19 *
22307600-C-T 20145714-C-T DYZ19 *
22303671-GTTTTGCTCACTTCAATAATGAATCTCCAGTCCTTTACGGTGAGTGTTACAGCACTTAATGGTGTTATGTCCAGAGTTTATTCCTTCAGATGTGTCCAGAGTT-G 20141785-GTTTTGCTCACTTCAATAATGAATCTCCAGTCCTTTACGGTGAGTGTTACAGCACTTAATGGTGTTATGTCCAGAGTTTATTCCTTCAGATGTGTCCAGAGTT-G DYZ19 *
22251649-T-G 20089763-T-G DYZ19 *
21235459-T-G 19073573-T-G YY*
21223245-G-A 19061359-G-A YY*
22835109-C-A 20673223-C-A YY*
18954383-C-A 16842503-C-A YY*
17918513-C-A 15806633-C-A YY*
17920991-G-T 15809111-G-T YY*
17923388-C-A 15811508-C-A YY*
18035622-T-C 15923742-T-C YY*
18232381-C-T 16120501-C-T Y*
18232385-T-G 16120505-T-G Y*
18232398-T-C 16120518-T-C Y*
18317417-G-A 16205537-G-A P6_Prx *
18597746-C-A 16485866-C-A YY*
18615900-C-A 16504020-C-A YY*
18643380-C-A 16531500-C-A YY*
18693631-T-A 16581751-T-A YY*
18744714-C-CTT 16632834-C-CTT 11×T*
18918784-C-A 16806904-C-A YY*
19008779-C-A 16896899-C-A YY*
21194378-C-CTT 19032492-C-CTT 11×T*
20379610-G-T 18217724-G-T P5_Dst *
21163395-C-A 19001509-C-A YY*
21163361-A-G 19001475-A-G YY*
18781816-T- P4_Dst *
20748613-G-A 18586727-G-A P4_Prx *
20675583-C-A 18513697-C-A P4_Prx *
20611520-G-T 18449634-G-T P5_Dst *
19469877-AC-A,CC 17357997-AC-A,CC 12×C*
19036672-T-A 16924792-T-A YY*
19436738-A-AAGAAAG,AAGAAAG 17324858-A-AAGAAAG,AAGAAAG 14×AG*
19409433-C-A 17297553-C-A YY*
19333229-ATTTTTT-A,AT 17221349-ATTTTTT-A,AT 21×T*
19299042-C-A 17187162-C-A Y*
19061169-C-A 16949289-C-A YY*
19040587-C-A 16928707-C-A YY*
22723386-C-CAAAAAAAAAAA 20561500-C-CAAAAAAAAAAA 17×A*
22894151-GAA-G,GAAA 20732265-GAA-G,GAAA 28×A*
15753196-T- *
56685595-G-T *
27761295-G-GAA 25615148-G-GAA P1_Y2 15×A*
28390952-A-T 26244805-A-T P1_gr2 *
28461072-C-A 26314925-C-A *
28480022-C-A 26333875-C-A *
28547044-G-A 26400897-G-A *
28549793-G-T 26403646-G-T *
28583542-T-C 26437395-T-C *
28591535-C-A 26445388-C-A *
28657515-G-T 26511368-G-T Y*
28658260-C-A 26512113-C-A Y*
28734578-C-A 26588431-C-A Y*
28800328-A-G 26654181-A-G *
28801556-TAGAA-T 26655409-TAGAA-T *
56685560-G-T *
56685606-G-C *
27030714-C-CT 24884567-C-CT P1_r4 13×T*
56831877-G-A,A 4×CATTC*
56842556-G-T *
56832766-A-C,C *
56832022-C-G *
56832010-CTCCAT-C *
56831884-A-T,T *
56831879-AT-A,A *
56831653-C-CTCCATCCCAT,CTCCATCCCAT *
56685642-A-T *
56831641-G-C,C *
56830983-G-GCTCCA,GCTGTA *
56756976-G-T *
56756908-G-C *
56707292-A-T *
56707002-T-C *
27423515-GTA-G,GTATA 25277368-GTA-G,GTATA P1_g3 24×TA*
26598581-GC-G 24452434-GC-G P1_g2 *
22997341-C-A 20835455-C-A Y*
23817825-A-C 21655939-A-C Y*
23026058-A-C 20864172-A-C YY*
23026061-T-C 20864175-T-C YY*
23134224-A-G 20972338-A-G YY*
23203190-G-C 21041304-G-C Y*
23280673-C-A 21118787-C-A YY*
23294119-C-T 21132233-C-T YY*
23327169-A-T 21165283-A-T YY*
23377255-C-T 21215369-C-T YY*
23416506-C-A 21254620-C-A YY*
23488834-TAAAA-T,TAAA 21326948-TAAAA-T,TAAA 30×A*
23522369-CA-C 21360483-CA-C *
23808507-C-A 21646621-C-A Y*
23817818-G-A 21655932-G-A Y*
23817820-C-T 21655934-C-T Y*
23875912-A-T 21714026-A-T *
26344249-CA-C,CAA 24198102-CA-C,CAA P1_Y1 14×A*
24869644-A-T 22723497-A-T IR1_R *
26242314-C-A 24096167-C-A P1_Y1 *
25842339-A-G 23696192-A-G P1_b3 *
25592746-G-A 23446599-G-A P1_gr1 *
25146698-C-A 23000551-C-A g1 *
24879118-A-T 22732971-A-T g1 *
24878095-T-A 22731948-T-A g1 *
24706222-G-A 22560075-G-A P3_b2 *
24119697-C-A 21973550-C-A P3_b1 *
24672659-G-T 22526512-G-T P3_b2 *
24636349-CTTTT-C 22490202-CTTTT-C P3_t2 17×T*
24404733-CTGTTTTAA-C 22258586-CTGTTTTAA-C *
24381915-TCTGTAA-T 22235768-TCTGTAA-T *
24381900-G-A 22235753-G-A Y*
24253519-C-A 22107372-C-A P3_b1 *
17884826-G-C 15772946-G-C Y*
17865060-C-A 15753180-C-A YY*
9340831-AACAC-A,AACACAC 9503222-AACAC-A,AACACAC 22×AC*
13483667-A-C 11327991-A-C *
13475338-G-C 11319662-G-C *
13476000-C-A 11320324-C-A *
13477230-T-A 11321554-T-A *
13477283-G-A 11321607-G-A *
13478257-G-GCAC,GCAC 11322581-G-GCAC,GCAC *
13478261-GGCA-G,G 11322585-GGCA-G,G *
13478321-C-G 11322645-C-G *
13478441-C-T 11322765-C-T *
13483285-TA-T 11327609-TA-T *
13483296-GC-G 11327620-GC-G *
13483327-A-T 11327651-A-T *
13483333-C-T 11327657-C-T *
13483432-T-G 11327756-T-G *
13483664-G-C 11327988-G-C *
13484097-C-T 11328421-C-T *
13474365-A-T 11318689-A-T *
13654209-A-T 11498533-A-T *
13814593-C-A 11693887-C-A *
13814400-G-GGGAATGGAATGGAAT,GGGAATGGAATGGAAT 11693694-G-GGGAATGGAATGGAAT,GGGAATGGAATGGAAT 10×GGAAT*
13800447-T-A 11679741-T-A *
13734173-A-AATGGC 11578497-A-AATGGC *
11538021-TGAAATGGAATGGAATGGAATGGAAC- *
13654226-A-G 11498550-A-G *
13644490-C-A 11488814-C-A *
13484123-C-A 11328447-C-A *
13489748-G-A 11334072-G-A *
13489197-G-T 11333521-G-T *
13487950-C-A 11332274-C-A *
13485743-A-G 11330067-A-G *
13485671-T-G,TAG 11329995-T-G,TAG *
13485666-GCA-G 11329990-GCA-G *
13475333-C-T 11319657-C-T *
13470583-CGG-C 11314907-CGG-C *
13825093-G-A 11704387-G-A *
10647819-C-A *
9371480-A-ATATATATATATATATATATATG 9533871-A-ATATATATATATATATATATATG *
9446081-G-T 9608472-G-T YY*
9459240-AT-A 9621631-AT-A 9×T*
9538409-G-T 9700800-G-T IR3_Prx *
9606418-G-T 9768809-G-T IR3_Prx *
9606660-G-T 9769051-G-T IR3_Prx *
9858979-G-T 10021370-G-T YY*
9873930-C-A 10036321-C-A Y*
9941122-G-T 10103513-G-T Y*
9954404-C-A 10116795-C-A Y*
9974352-A-ATT 10136743-A-ATT *
10020511-C-CAAAAG,CAAAAG 10182902-C-CAAAAG,CAAAAG 10×AAAAG*
10024768-C-A 10187159-C-A Y*
10036746-C-A 10199137-C-A *
11033928-T-C,C *
13470538-G-GCC 11314862-G-GCC *
13449324-C-A 11293648-C-A *
13470533-C-A 11314857-C-A *
13468958-C-G 11313282-C-G *
13465753-C-T 11310077-C-T *
13465750-C-A 11310074-C-A *
13465064-A-G 11309388-A-G *
56858540-A-AGAAG ***
13435194-C-A 11279518-C-A *
11033932-ATTCTG-A,A *
13312577-C-A 11156901-C-A *
13282710-C-A 11127034-C-A *
13254050-T-C 11098374-T-C *
11033948-C-CAT,CAT *
11033944-TCA-T,T *
11033941-C-G,G *
13815150-G-A 11694444-G-A *
13839817-A-T 11719111-A-T *
17815785-TGTGAGA-T 15703905-TGTGAGA-T *
16033921-G-T 13922041-G-T Y9×T*
15739629-ACATCTTG-A 13627749-ACATCTTG-A *
15776658-C-A 13664778-C-A YY*
15786438-C-A 13674558-C-A YY*
15864412-T-C 13752532-T-C YY*
15911719-T-C 13799839-T-C YY*
15931326-T-C 13819446-T-C YY*
15950314-G-T 13838434-G-T YY*
16006655-G-T 13894775-G-T YY*
16015352-C-A 13903472-C-A Y*
16016743-C-G 13904863-C-G Y*
16016752-AC-A 13904872-AC-A *
16016754-AC-A 13904874-AC-A *
16016776-C-A 13904896-C-A Y*
16033920-G-GT 13922040-G-GT *
16180652-T-C 14068772-T-C Y*
15722451-C-A 13610571-C-A YY*
17050099-CT-C,TT 14938219-CT-C,TT 15×T*
17668088-C-A 15556208-C-A YY*
17650183-C-A 15538303-C-A YY*
17497938-C-A 15386058-C-A YY*
17380863-C-A 15268983-C-A YY*
17296350-C-A 15184470-C-A YY*
17086782-C-A 14974902-C-A YY*
14845875-AT- *
16247803-C-A 14135923-C-A YY*
16749904-C-A 14638024-C-A YY*
16613618-A-AAG 14501738-A-AAG 8×AG*
16584848-C-A 14472968-C-A YY*
16482321-TTAAATATA-T 14370441-TTAAATATA-T *
16412782-C-A 14300902-C-A YY*
16351315-C-A 14239435-C-A YY*
15739504-A-G 13627624-A-G YY*
15527396-C-A 13415516-C-A YY*
13839819-T-C 11719113-T-C *
14527251-C-A 12415452-C-A Y*
13841496-A-G 11720790-A-G *
13856736-TCGAAA-T 11736030-TCGAAA-T *
13866584-G-T 11745878-G-T *
13928459-C-G 11807753-C-G Y*
13934483-C-A 11813777-C-A Y*
14151655-C-A 12030949-C-A YY*
14151684-C-G 12030978-C-G YY*
14174243-A-G 12053537-A-G YY*
14216058-C-A 12095352-C-A YY*
14221230-C-A 12100524-C-A YY*
14369933-C-A 12249229-C-A YY*
14393872-C-A 12273168-C-A YY*
14422085-C-T 12301360-C-T Y*
14488460-C-A 12367729-C-A YY*
14527319-C-A 12415520-C-A Y*
15479986-C-A 13368106-C-A YY*
15001576-A-G 12889661-A-G YY*
15468678-CAA-C,CAAAA 13356798-CAA-C,CAAAA 23×A*
15374441-G-GT,GTT 13262561-G-GT,GTT 20×T*
15278542-A-G 13166631-A-G YY*
15220734-C-A 13108820-C-A Y*
15168683-A-G 13056769-A-G Y*
15059478-C-T 12947570-C-T YY*
14946117-C-A 12834191-C-A YY*
14577312-C-A 12465512-C-A YY*
14696124-C-A 12584190-C-A YY*
14619972-CT-C 12508170-CT-C *
14592781-C-A 12480981-C-A YY*
14588741-G-T 12476941-G-T YY*
14578121-C-A 12466321-C-A YY*
14577341-T-C 12465541-T-C YY*
9508051-C-A 9670442-C-A *
9221660-CATATATAT-C,CAT 9384051-CATATATAT-C,CAT 27×AT*
7723037-C-A 7854996-C-A YY*
22186713-C-CAAA 20024827-C-CAAA 16×A*
9073911-C-A 9236302-C-A Y*
8399123-C-A 8531082-C-A FT167745 YY****
17678621-CTTTT-C,CTT 15566741-CTTTT-C,CTT 26×T*
5976616-C-A 6108575-C-A *
22361465-C-G 20199579-C-G DYZ19 *
5406475-C-A 5538434-C-A ***
17446767-CTT-C 15334887-CTT-C 33×T*
16623865-G-T 14511985-G-T Y****
10882872-C-A ****
10662947-C-T *
10690293-C-A ****
16275977-C-T 14164097-C-T YY****
13474498-C-A 11318822-C-A *
17815308-A-ATT 15703428-A-ATT 12×T*
10032013-G-A 10194404-G-A Y****
15743328-C-A 13631448-C-A Y***
15168703-C-A 13056789-C-A Y*
13485754-C-A 11330078-C-A *
14392735-CTTTTT-C 12272031-CTTTTT-C 17×T*
17749455-C-A 15637575-C-A YY*
15620045-C-A 13508165-C-A YY*
28673303-C-A 26527156-C-A *
21033572-C-A 18871686-C-A Y****
58883797-T-G 56707074-A-C *
18756798-GTT-G,GT 16644918-GTT-G,GT 19×T*
9859192-CA-C,CAA 10021583-CA-C,CAA 17×A*
19429661-C-T 17317781-C-T YY****
17128582-C-A 15016702-C-A YY*
13480865-C-A 11325189-C-A *
15412836-C-A 13300956-C-A YY*
15533061-C-A 13421181-C-A Y*
7970860-C-CTT 8102819-C-CTT 12×T*
18838684-CA-C 16726804-CA-C ****
7436239-A-G 7568198-A-G Y****
18614217-C-A 16502337-C-A YY*
16679628-C-A 14567748-C-A YY*
18406785-C-A 16294905-C-A P6_Gap ****
17436513-G-T 15324633-G-T YY*
4408503-C-A 4540462-C-A *
15278725-C-A 13166814-C-A YY****
21382408-C-A 19220522-C-A Y****
13477160-C-A 11321484-C-A ****
13483674-C-A 11327998-C-A *
14714554-C-T 12602621-C-T BY97263 YY*
13725879-C-G 11570203-C-G *
13487235-T-C 11331559-T-C ****
13487960-C-T 11332284-C-T *
22730058-C-A 20568172-C-A YY*
13448878-C-A 11293202-C-A *
13474388-G-C 11318712-G-C *
13810973-C-A 11690267-C-A BY46525 ****
13470433-C-T 11314757-C-T ****
6231191-G-A 6363150-G-A IR3_Dst *
20063941-TAAA-T,TAA 17952061-TAAA-T,TAA P5_Gap 18×A*
10911952-C-A ****
9977816-C-A 10140207-C-A Y*
2783717-CA-C 2915676-CA-C 8×A*
13463801-C-A 11308125-C-A *
13485753-G-A 11330077-G-A FT444191 *
28583107-G-T 26436960-G-T ***
18679925-CAAA-C,CAA 16568045-CAAA-C,CAA 25×A*
4229169-C-T 4361128-C-T ***
8736429-C-A 8868388-C-A Y****
4136649-C-A 4268608-C-A ***
7185014-C-A 7316973-C-A Y***
6149833-C-A 6281792-C-A IR3_Dst *
23277816-C-A 21115930-C-A YY****
56724816-A-G *
7899229-C-A 8031188-C-A YY*
9512138-C-A 9674529-C-A *
9104377-C-A 9266768-C-A Y*
4567312-CAAA-C 4699271-CAAA-C 13×A*
4240671-C-A 4372630-C-A *
17789788-CT-C 15677908-CT-C 9×T*
20614906-C-A 18453020-C-A P4_Prx *
13483360-A-G 11327684-A-G *
23471038-CAAAA-C,CAAA 21309152-CAAAA-C,CAAA 19×A*
3848733-C-A 3980692-C-A *
21616210-C-A 19454324-C-A YY*
4961411-G-T 5093370-G-T *
14394468-TAAAA-T,TAAA 12273764-TAAAA-T,TAAA 16×A*
25173587-TACAC-T 23027440-TACAC-T g1 17×AC*
28462826-G-T 26316679-G-T *
9186909-C-G 9349300-C-G Y*
13479388-G-C 11323712-G-C *
23061711-G-T 20899825-G-T Y***
19132676-CA-C 17020796-CA-C 8×A*
21766533-A-AATATAT 19604647-A-AATATAT 19×AT*
13450880-C-CCACTCCACTCCTCTCCCCAA 11295204-C-CCACTCCACTCCTCTCCCCAA *
13740237-G-A 11584561-G-A *
13465475-C-T 11309799-C-T *
26538868-TTATA-T 24392721-TTATA-T P1_g2 16×TA*
13479410-C-G 11323734-C-G *
19409424-C-A 17297544-C-A YY*
13489175-A-C 11333499-A-C *
22341556-G-A 20179670-G-A DYZ19 *
7420321-T-C 7552280-T-C PF1527 M5073 CTS1463 YY*
22251287-T-C 20089401-T-C DYZ19 *
22505257-T-G 20343371-T-G DYZ19 *
58883662-T-C 56707209-A-G *
22220202-A-G 20058316-A-G DYZ19 *
24036989-AT-A 21890842-AT-A 11×T*
21644438-T-G 19482552-T-G YY*
8696594-A-G 8828553-A-G YY*
22251308-T-G 20089422-T-G DYZ19 *
9730344-C-CAT 9892735-C-CAT IR3_Prx *
22298332-A-G 20136446-A-G BY216669 DYZ19 *
22298327-C-G 20136441-C-G FT455398 DYZ19 *
9992125-A-T 10154516-A-T Y*
22298291-A-G 20136405-A-G DYZ19 *
13717881-A-C 11562205-A-C *
15313925-T-C 13202030-T-C CTS3988 PF1664 M5161 YY*
28245714-AT-A 26099567-AT-A P1_b4 15×T*
9296364-T-C 9458755-T-C Y*
26707123-CT-C 24560976-CT-C P1_g2 13×T*
19409420-C-A 17297540-C-A YY*
28812994-G-C 26666847-G-C A4541 *
22364444-T-A 20202558-T-A DYZ19 *
13522019-G-A 11366343-G-A FT255332 *
22520812-G-A 20358926-G-A Y*
13743034-T-A 11587358-T-A ****
22298397-C-T 20136511-C-T DYZ19 *
22228430-C-T 20066544-C-T DYZ19 *
22360622-A-T 20198736-A-T DYZ19 *
4902612-G-T 5034571-G-T *
6286901-C-CA 6418860-C-CA IR3_Dst 10×A*
27676312-AAAAAT-A 25530165-AAAAAT-A P1_Y2 6×AAAAT*
22505733-T-G 20343847-T-G DYZ19 *
13726590-T-TATGGAATGGAATGGAATGGAATGGA 11570914-T-TATGGAATGGAATGGAATGGAATGGA *
9189278-TCAAAA-T 9351669-TCAAAA-T 6×CAAAA*
13726626-T-G 11570950-T-G *
22505681-A-T 20343795-A-T DYZ19 *
13726647-A-T 11570971-A-T *
13489162-C-A 11333486-C-A *
22202421-A-G 20040535-A-G YY****
17281258-G-T 15169378-G-T E101 YY*
58981921-T-A 56835774-T-A *
22509092-T-G 20347206-T-G DYZ19 *
13623911-CATAT-C 11468235-CATAT-C 10×AT*
22509088-G-C 20347202-G-C DYZ19 *
21092176-C-T 18930290-C-T YY*
58905197-T-A 56685674-A-T *
24907781-T-TAA 22761634-T-TAA g1 22×A*
22366581-G-A 20204695-G-A DYZ19 *
13291099-C-A 11135423-C-A *
8537640-TTG-T 8669599-TTG-T *
23702223-G-GT 21540337-G-GT 14×T*
21935330-AAAAC-A 19773444-AAAAC-A 4×AAAC*
22364756-G-C 20202870-G-C DYZ19 *
13726383-C-G,T 11570707-C-G,T *
22488584-C-T 20326698-C-T BY2057 A4388 DYZ19 *
9316120-CTTG-C 9478511-CTTG-C *
13485744-T-C 11330068-T-C *
13737025-T-C 11581349-T-C *
22360610-C-G 20198724-C-G DYZ19 *
22341563-G-T 20179677-G-T DYZ19 *
13478364-G-T 11322688-G-T *
22509615-T-G 20347729-T-G DYZ19 *
27824063-G-GT 25677916-G-GT P1_Y2 10×T*
2708335-C-A 2840294-C-A **
2730040-G-T 2861999-G-T **
2762134-G-T 2894093-G-T **
3251904-G-C 3383863-G-C **
10776049-C-G **
3704648-T-G 3836607-T-G **
6916068-G-C 7048027-G-C **
2900811-A-G 3032770-A-G **
8482001-G-A 8613960-G-A **
3688446-C-A 3820405-C-A **
2980245-A-G 3112204-A-G **
3640753-G-C 3772712-G-C **
19932026-T-A 17820146-T-A P5_Prx **
3640358-T-A 3772317-T-A **
3090388-C-A 3222347-C-A **
3326769-G-T 3458728-G-T **
13461013-T-G 11305337-T-G **
3345619-A-G 3477578-A-G **
4434072-T-C 4566031-T-C **
6911260-G-A 7043219-G-A **
6091111-T-C 6223070-T-C **
6776246-C-A 6908205-C-A **
5560617-C-A 5692576-C-A **
5603496-TA-T 5735455-TA-T **
5669878-G-C 5801837-G-C **
5675755-G-T 5807714-G-T **
5683375-C-T 5815334-C-T **
5774749-C-A 5906708-C-A **
5873693-A-G 6005652-A-G **
5935442-A-G 6067401-A-G **
6224850-C-A 6356809-C-A IR3_Dst **
5188772-CA-C 5320731-CA-C **
6375507-A-G 6507466-A-G **
6478545-G-A 6610504-G-A **
6511831-C-A 6643790-C-A **
6772175-G-C 6904134-G-C **
6511878-T-C 6643837-T-C **
6582409-T-A 6714368-T-A **
6582411-C-G 6714370-C-G **
6596441-G-T 6728400-G-T FT96030 **
6682269-A-T 6814228-A-T **
6755964-C-A 6887923-C-A **
5359003-T-G 5490962-T-G **
5146792-T-A 5278751-T-A **
3804848-T-C 3936807-T-C **
6786874-C-T 6918833-C-T **
3990955-A-G 4122914-A-G **
3998519-T-C 4130478-T-C **
3998910-G-T 4130869-G-T **
4065254-T-G 4197213-T-G **
4095095-ATATATATGTGTCT-A 4227054-ATATATATGTGTCT-A **
4212578-C-A 4344537-C-A **
4357501-A-C 4489460-A-C **
6833120-C-A 6965079-C-A **
4357537-A-C 4489496-A-C **
4434071-T-C 4566030-T-C **
6772149-A-C 6904108-A-C **
4958358-T-A 5090317-T-A **
4444977-A-C 4576936-A-C **
4469958-T-A 4601917-T-A **
4627168-C-A 4759127-C-A **
4754860-T-G 4886819-T-G **
4754958-A-T 4886917-A-T **
4755094-T-C 4887053-T-C **
4755206-C-A 4887165-C-A **
4756595-T-C 4888554-T-C **
4757294-T-A 4889253-T-A **
4951394-C-A 5083353-C-A **
24070721-G-T 21924574-G-T P3_b1 **
56845207-G-A **
10667726-G-A FT428709 **
4874856-G-T 5006815-G-T **
4460158-C-A 4592117-C-A **
11030180-T-A **
11030205-C-A **
5829235-C-A 5961194-C-A **
15191165-C-A 13079251-C-A **
17713894-C-A 15602014-C-A **
14485192-G-T 12364461-G-T **
11030218-C-T **
16411244-C-A 14299364-C-A **
15399448-C-A 13287568-C-A **
13993440-C-A 11872734-C-A FT190472 **
19129053-C-CTTT 17017173-C-CTTT 16×T**
7143407-C-A 7275366-C-A **
4957801-A-T 5089760-A-T **
10850619-G-A **
10850622-A-G **
13613585-C-A 11457909-C-A **
4374752-C-A 4506711-C-A **
10850627-G-T **
14802792-C-A 12690863-C-A **
18908089-T-C 16796209-T-C FGC10427 **
7209910-G-A 7341869-G-A **
13566205-C-T 11410529-C-T **
14397864-T-G 12277160-T-G ****
18039415-A-T 15927535-A-T **
6637383-C-A 6769342-C-A **
26170439-A-C 24024292-A-C P1_Y1 **
4840199-C-A 4972158-C-A **
15370833-C-A 13258953-C-A **
10887361-T-A **
10887370-T-C **
22963715-C-A 20801829-C-A **
21367616-C-A 19205730-C-A **
3061173-C-A 3193132-C-A FT74344 **
11030160-A-ATTCCAT **
18717756-G-A 16605876-G-A **
22321502-C-A 20159616-C-A DYZ19 **
10850626-G-A FT434072 **
8668423-C-A 8800382-C-A **
21244196-C-A 19082310-C-A **
16017752-C-A 13905872-C-A **
4438514-C-A 4570473-C-A **
19899590-GA-G 17787710-GA-G P5_Prx **
6918534-T-C 7050493-T-C **
23004855-T-C 20842969-T-C **
5242677-C-A 5374636-C-A **
22203735-C-A 20041849-C-A FT392870 **
3046593-C-A 3178552-C-A **
18192365-C-A 16080485-C-A **
15060666-C-A 12948758-C-A **
18050289-C-A 15938409-C-A **
14442953-C-A 12322226-C-A **
14743143-A-G 12631211-A-G **
15150693-C-A 13038780-C-A **
17728583-C-A 15616703-C-A **
10970692-C-A **
13922543-A-C 11801837-A-C **
28548794-C-A 26402647-C-A **
21163173-C-A 19001287-C-A **
6948124-G-TTT 7080083-G-TTT **
22518525-C-A 20356639-C-A **
13226562-C-A 11070886-C-A **
10667828-G-C **
7339040-C-A 7470999-C-A **
6916104-T-A 7048063-T-A **
3804429-C-A 3936388-C-A **
17702652-C-A 15590772-C-A **
8786732-T-C 8918691-T-C **
21608024-C-A 19446138-C-A **
14033971-C-A 11913265-C-A **
10850621-T-G **
15073290-C-A 12961380-C-A **
16814041-C-A 14702161-C-A **
15221913-C-A 13109999-C-A **
10850567-T-A **
18130669-C-A 16018789-C-A **
16384617-C-A 14272737-C-A **
14784743-C-A 12672813-C-A **
6916101-A-G 7048060-A-G **
6916158-G-A 7048117-G-A **
6916116-T-A 7048075-T-A **
18406450-C-A 16294570-C-A P6_Gap **
18880241-C-A 16768361-C-A **
18750170-A-G 16638290-A-G **
18707155-G-A 16595275-G-A **
18682757-G-A 16570877-G-A **
18615963-A-C 16504083-A-C **
18539080-T-G 16427200-T-G **
18288539-C-A 16176659-C-A P6_Prx **
18966940-A-G 16855060-A-G **
18226495-A-T 16114615-A-T **
18189626-T-A 16077746-T-A **
18086930-T-A 15975050-T-A **
17916341-C-A 15804461-C-A **
17884605-C-G 15772725-C-G **
17869595-C-A 15757715-C-A **
18956296-C-A 16844416-C-A **
18966945-A-G 16855065-A-G **
17580207-C-A 15468327-C-A **
20802929-C-A 18641043-C-A P4_Gap **
21467941-T-A 19306055-T-A **
21416684-C-A 19254798-C-A FGC31135 **
21416648-T-C 19254762-T-C **
21306524-GT-G 19144638-GT-G **
21141141-C-A 18979255-C-A **
20825088-C-A 18663202-C-A P4_Gap **
20760063-T-TC 18598177-T-TC P4_Prx **
18966952-A-C 16855072-A-C **
20535097-C-A 18373211-C-A P5_Dst **
19692990-T-TTC 17581110-T-TTC P5_Prx **
19464062-G-T 17352182-G-T **
19449253-C-A 17337373-C-A **
19318214-A-G 17206334-A-G **
19071026-A-C 16959146-A-C **
17663109-A-G 15551229-A-G **
17548626-T-G 15436746-T-G **
21697284-G-T 19535398-G-T **
15866243-T-G 13754363-T-G **
16240899-G-A 14129019-G-A **
16108704-T-TTCTTA 13996824-T-TTCTTA P8_Prx **
16038859-C-A 13926979-C-A **
16019083-C-A 13907203-C-A **
16017724-C-A 13905844-C-A **
15924130-G-A 13812250-G-A **
15843089-A-G 13731209-A-G **
16471309-G-A 14359429-G-A **
15763985-C-A 13652105-C-A **
6916133-T-A 7048092-T-A **
15756655-G-T 13644775-G-T **
15756397-C-A 13644517-C-A **
15732883-G-C 13621003-G-C **
15686722-C-A 13574842-C-A **
16295630-G-T 14183750-G-T **
16530996-A-G 14419116-A-G **
17318326-T-G 15206446-T-G **
16783595-C-A 14671715-C-A **
17211624-G-A 15099744-G-A **
17104114-C-A 14992234-C-A **
17064844-C-A 14952964-C-A **
16926164-G-C 14814284-G-C **
16896614-C-A 14784734-C-A **
16847610-C-A 14735730-C-A **
16713035-C-G 14601155-C-G **
16583371-C-G 14471491-C-G **
16703001-C-G 14591121-C-G **
16682766-C-G 14570886-C-G **
16682740-C-A 14570860-C-A **
16645621-C-A 14533741-C-A **
16625637-A-T 14513757-A-T **
16625559-A-G 14513679-A-G **
16625500-A-C 14513620-A-C **
21500467-G-T 19338581-G-T **
21823343-A-C 19661457-A-C **
15392184-A-T 13280304-A-T **
28759476-A-C 26613329-A-C **
28624650-A-G 26478503-A-G **
28638122-C-A 26491975-C-A **
28640982-C-A 26494835-C-A **
28720040-G-A 26573893-G-A **
28722121-C-G 26575974-C-G **
28747621-T-C 26601474-T-C **
28775366-C-A 26629219-C-A **
28600618-A-G 26454471-A-G **
56830222-C-A **
56839277-A-G **
56845208-C-T **
56845219-C-T **
56845226-C-G **
56845233-G-A **
28609553-T-C 26463406-T-C **
28600580-C-G 26454433-C-G **
56845271-T-A **
26152211-C-CTTGG 24006064-C-CTTGG P1_Y1 **
24878328-G-T 22732181-G-T g1 **
24890855-C-T 22744708-C-T g1 **
25587243-T-TA 23441096-T-TA P1_gr1 **
25995495-T-G 23849348-T-G P1_Y1 **
25995538-ATA-G 23849391-ATA-G P1_Y1 **
26095159-G-T 23949012-G-T P1_Y1 **
26260674-G-C 24114527-G-C P1_Y1 **
28544265-A-G 26398118-A-G **
26922228-G-C 24776081-G-C P1_r3 **
26922253-T-C 24776106-T-C P1_r3 **
26922305-T-C 24776158-T-C P1_r3 **
26922323-G-A 24776176-G-A P1_r3 **
28159372-C-A 26013225-C-A P1_b4 **
28461637-A-G 26315490-A-G FT60400 **
28499464-C-A 26353317-C-A **
56845243-G-C **
56845273-A-C **
21834181-A-G 19672295-A-G 4×GTTTT**
22091199-T-G 19929313-T-G **
22666032-C-T 20504146-C-T **
22666031-C-T 20504145-C-T **
22666026-T-C 20504140-T-C **
22665999-G-A 20504113-G-A **
22204793-G-T 20042907-G-T **
22125208-A-G 19963322-A-G **
22088981-A-G 19927095-A-G **
22666066-T-G 20504180-T-G **
22076883-C-A 19914997-C-A **
22055300-C-A 19893414-C-A **
21967055-T-A 19805169-T-A **
21874986-G-T 19713100-G-T **
21862226-C-A 19700340-C-A **
21836358-T-C 19674472-T-C **
22666065-A-G 20504179-A-G **
22666069-G-A 20504183-G-A **
56845284-C-T **
23029757-A-C 20867871-A-C **
56845289-T-C **
23637-G-A **
23516569-A-G 21354683-A-G **
23261317-C-G 21099431-C-G **
23252621-T-C 21090735-T-C **
23035884-G-A 20873998-G-A **
23007051-C-T 20845165-C-T **
22666077-A-G 20504191-A-G **
22874365-C-A 20712479-C-A **
22824907-C-A 20663021-C-A **
22810111-T-C 20648225-T-C **
22810088-C-G 20648202-C-G **
22782989-C-A 20621103-C-A **
22767634-T-C 20605748-T-C **
22666080-C-T 20504194-C-T **
15396535-C-A 13284655-C-A **
23285226-T-A 21123340-T-A **
15379858-G-C 13267978-G-C **
10658413-A-G **
10690143-G-T **
10670915-T-A **
10667802-T-A **
10667713-A-T **
10665420-C-A **
10658422-C-T **
10657374-C-T **
10767850-C-G **
10040895-C-A 10203286-C-A **
10010440-C-A 10172831-C-A **
9996253-C-A 10158644-C-A **
9933186-G-T 10095577-G-T **
9931539-T-C 10093930-T-C **
9927336-C-A 10089727-C-A **
10767846-C-CATTAT **
10767852-A-G **
9173189-A-T 9335580-A-T **
10819265-C-G **
10850586-A-G **
10850581-A-G **
10850573-T-G **
10850562-T-C **
10845655-C-T **
10819268-C-T **
15365051-A-G 13253171-A-G **
10767870-C-A **
10809022-G-T **
10792725-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-C **
10778673-C-A **
10776057-T-A **
10776051-A-G **
10775991-A-ACACCG **
9416813-T-G 9579204-T-G **
9173188-C-G 9335579-C-G **
10850610-C-T **
7223073-T-A 7355032-T-A **
7422400-C-A 7554359-C-A **
7390560-T-C 7522519-T-C **
7359795-T-A 7491754-T-A **
7341622-C-A 7473581-C-A **
7239622-A-G 7371581-A-G **
7229022-C-A 7360981-C-A **
7214455-C-A 7346414-C-A Y83619 **
7713218-A-G 7845177-A-G **
7162224-G-T 7294183-G-T **
7155580-A-C 7287539-A-C **
5414895-A-G 5546854-A-G **
7155546-T-A 7287505-T-A **
7060956-T-C 7192915-T-C **
24518298-C-A 22372151-C-A **
7524712-C-A 7656671-C-A **
7754069-A-C 7886028-A-C **
9173187-C-G 9335578-C-G **
9030357-A-C 9192748-A-C **
9173180-T-A 9335571-T-A **
9173164-G-A 9335555-G-A **
9173162-C-T 9335553-C-T **
9173153-C-T 9335544-C-T **
9173152-G-T 9335543-G-T **
9173134-A-G 9335525-A-G **
9025195-C-T 9187586-C-T **
7964793-C-A 8096752-C-A **
8879583-C-A 9011542-C-A **
8848373-C-A 8980332-C-A **
8840642-C-A 8972601-C-A **
8735427-T-C 8867386-T-C **
8095551-T-C 8227510-T-C **
7984545-A-G 8116504-A-G **
10850596-A-T FT357996 **
10819261-A-C **
10864479-C-A **
14174936-C-A 12054230-C-A **
14367861-G-T 12247157-G-T **
14343829-C-A 12223124-C-A **
14328187-T-C 12207481-T-C **
14250482-C-A 12129776-C-A **
14229988-T-C 12109282-T-C **
14181455-A-C 12060749-A-C **
14181435-C-T 12060729-C-T **
14159691-A-G 12038985-A-G **
14431172-T-C 12310445-T-C **
14069082-A-G 11948376-A-G **
14068464-C-A 11947758-C-A **
13981794-C-T 11861088-C-T **
13920585-G-T 11799879-G-T **
13919097-T-C 11798391-T-C **
13857560-G-A 11736854-G-A **
13855584-T-A 11734878-T-A **
14405859-C-A 12285156-C-A **
14470466-C-T 12349735-C-T **
10914908-C-A **
15061690-C-A 12949782-C-A 13×T**
15297155-G-A 13185254-G-A **
15252799-G-C 13140885-G-C **
15189632-T-A 13077718-T-A **
15189631-G-A 13077717-G-A **
15173495-AT-A 13061581-AT-A **
15115185-C-A 13003272-C-A **
15084579-A-G 12972669-A-G **
15045242-T-A 12933332-T-A **
14485154-T-C 12364423-T-C **
14743490-A-C 12631559-A-C **
14714945-A-G 12603012-A-G **
14714848-T-C 12602915-T-C **
14627213-G-T 12515281-G-T **
14533441-C-A 12421642-C-A **
14530831-C-T 12419032-C-T **
14501281-T-C 12389486-T-C **
14485170-T-C 12364439-T-C **
13846970-C-A 11726264-C-A **
11674773-G-A FT229977 **
13479636-A-T 11323960-A-T **
13480970-A-G 11325294-A-G **
13487137-C-T 11331461-C-T **
13553375-A-C 11397699-A-C **
13472328-C-A 11316652-C-A **
13229533-T-A 11073857-T-A **
13226245-G-C 11070569-G-C **
13209513-G-A 11053837-G-A **
13553382-A-T 11397706-A-T **
11001385-T-G **
13553385-G-A 11397709-G-A **
13725134-A-T 11569458-A-T **
11642978-G-A **
11657429-A-C **
11001324-A-G FTB2005 **
11662434-A-C **
11001297-C-A **
11001290-T-A **
10992851-GCATTC-G **
10987743-T-TCACTC **
10982395-C-A **
10965592-T-C **
10946379-C-A **
10928919-A-C **
10914919-C-A **
13450028-C-TACTCA 11294352-C-TACTCA ***
22238360-A-G 20076474-A-G DYZ19 ***
24329517-T-C 22183370-T-C P3_t1 ***
10673874-A-ACTAAC ***
3833652-CAAAAAA-C 3965611-CAAAAAA-C 16×A***
25221433-T-C 23075286-T-C P2_r1 ***
24082711-C-G 21936564-C-G P3_b1 ***
22247688-C-T 20085802-C-T DYZ19 ***
25031565-A-T 22885418-A-T g1 ***
13866438-C-T 11745732-C-T FT192802 ***
25143302-G-A 22997155-G-A g1 ***
25160589-G-C 23014442-G-C g1 ***
23817850-T-C 21655964-T-C ***
26074056-TG-T 23927909-TG-T P1_Y1 ***
13450104-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCACTCCATTCCATTCCAT 11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCACTCCATTCCATTCCAT ***
10657342-T-A ***
13631959-C-A 11476283-C-A ***
13634314-C-A 11478638-C-A ***
56826662-C-A ***
10671217-T-C,C ***
10673877-C-G ***
10673860-T-TTCTGC ***
24230034-C-T 22083887-C-T P3_b1 ***
21411717-GCAAA-G 19249831-GCAAA-G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B107561080168578343967921751
Kit: B10756974156979641647884523
Kit: B107561014696479240827784839
Used in age calculations1080168579641647921751
Counts of SNPs213174
Variant counts last updated 2022-11-21 03:16:40.



Big Tree Main Page