Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z2959 > Z46375 > DF106 > DF104 > DF105 > A18726 > A259 > Y19870 > BY11725 > A10525 > BY18145

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-YSEQ
41733
5587950-C-T 5719909-C-T FT159195 +
9204506-C-G 9366897-C-G Y+
18195154-A-ATTTTTTTT 16083274-A-ATTTTTTTT 29×T+
7195324-G-T 7327283-G-T YY+
10851056-A-G +
11022933-A-G +
21116756-A-G 18954870-A-G FT367336 YY+
22502939-C-G 20341053-C-G DYZ19 +
21501086-A-ATTTTTTTTTT 19339200-A-ATTTTTTTTTT 37×T+
11022909-T-G +
21558301-T-C 19396415-T-C YY+
58906099-A-C 56684772-T-G +
22352583-T-G 20190697-T-G DYZ19 +
22802868-A-ATTT 20640982-A-ATTT 32×T+
23333221-C-A 21171335-C-A Y+
24904882-G-A 22758735-G-A g1 +
7195326-G-T 7327285-G-T YY+
17998293-T-C 15886413-T-C P7_Gap Y+
28486984-T-C 26340837-T-C +
16834746-C-CAAAAAAAA 14722866-C-CAAAAAAAA 45×A+
5147441-C-CAAAAAA 5279400-C-CAAAAAA 30×A+
5109367-C-T 5241326-C-T +
3351551-G-A 3483510-G-A +
8681281-T-C 8813240-T-C YY+
8826678-C-CAAAAAAAAAAAAAA 8958637-C-CAAAAAAAAAAAAAA 29×A+
9109382-C-T 9271773-C-T Y+
11022910-TCC-T +
56680274-G-A +
11022913-A-ATG +
13525264-T-C 11369588-T-C +
13671394-TGGAATGGAATCAAAC-T 11515718-TGGAATGGAATCAAAC-T +
5986607-T-G 6118566-T-G +
5986601-T-G 6118560-T-G +
14020024-C-T 11899318-C-T Y+
7387396-A-ATTT 7519355-A-ATTT 22×T+
16551094-C-T 14439214-C-T YY+
28804559-C-T 26658412-C-T +
28573079-C-T 26426932-C-T *
13561112-A-G 11405436-A-G *
13689694-T-C 11534018-T-C *
56692409-A-G *
13643398-T-A 11487722-T-A *
13634398-A-G 11478722-A-G *
13565073-A-G 11409397-A-G *
13564280-C-T 11408604-C-T *
13515744-G-T 11360068-G-T *
56832380-C-CATTAG *
13700726-A-G 11545050-A-G *
13506465-G-C 11350789-G-C *
13494877-T-A 11339201-T-A *
13494661-C-A 11338985-C-A *
11333941-C- *
13489209-A-G 11333533-A-G *
13486878-C-CTCCTGGGTGATCAGTGCATAT 11331202-C-CTCCTGGGTGATCAGTGCATAT *
13689705-A-G 11534029-A-G *
13701639-GA-G 11545963-GA-G *
13483358-T-A 11327682-T-A *
13717691-C-T 11562015-C-T *
13734409-A-T 11578733-A-T *
13734362-G-C 11578686-G-C *
13723489-A-G 11567813-A-G *
13720844-A-T 11565168-A-T *
13720843-G-T 11565167-G-T *
13719974-A-T 11564298-A-T *
13719937-G-T 11564261-G-T *
13715124-ATG-A 11559448-ATG-A *
11545964-A- *
13714030-T-A 11558354-T-A *
13713467-T-A 11557791-T-A *
13713218-G-T 11557542-G-T *
13713181-G-C 11557505-G-C *
13713169-G-T 11557493-G-T *
13701644-G-GT 11545968-G-GT *
13701643-C-T 11545967-C-T *
13483369-C-CT 11327693-C-CT *
13480205-G-A 11324529-G-A *
13842010-ATGGAG-A 11721304-ATGGAG-A *
13344682-C-A 11189006-C-A *
13432612-T-C 11276936-T-C *
13412975-T-C 11257299-T-C *
13406728-T-C 11251052-T-C *
13393283-A-G 11237607-A-G *
13349167-C-T 11193491-C-T *
13348603-A-G 11192927-A-G *
13348599-G-A 11192923-G-A *
13338278-G-C 11182602-G-C *
13442596-A-G 11286920-A-G *
13312094-T-C 11156418-T-C *
13297542-C-T 11141866-C-T *
13277171-C-G 11121495-C-G *
13264776-T-C 11109100-T-C *
13260838-G-GT 11105162-G-GT *
13248696-A-C 11093020-A-C *
13241202-G-A 11085526-G-A *
13432888-G-GTGTC 11277212-G-GTGTC *
11292649-CAGT- *
13480201-C-G 11324525-C-G *
13463957-C-CCA 11308281-C-CCA *
13470529-T-TAG 11314853-T-TAG *
13470527-G-GATATTTCACAAAGCCTTCT 11314851-G-GATATTTCACAAAGCCTTCT *
13470523-C-A 11314847-C-A *
13468624-GATGATCAGTGCAGAGATATGTCACAACCCCCTGTAGGCAGAGCTTAGAC-G 11312948-GATGATCAGTGCAGAGATATGTCACAACCCCCTGTAGGCAGAGCTTAGAC-G *
13467954-G-C 11312278-G-C *
13465021-T-A 11309345-T-A *
13463971-C-A 11308295-C-A *
13463954-C-CTG 11308278-C-CTG *
11293366-G- *
13461329-C-T 11305653-C-T *
13458715-C-CT 11303039-C-CT *
13458712-AC-A 11303036-AC-A *
13458413-T-G 11302737-T-G *
13454859-T-C 11299183-T-C *
13451895-TTTCATTCACCTCAAA-T 11296219-TTTCATTCACCTCAAA-T *
11294438-CCCCATCCCATCCCATTCTATTCCATTCCATTCCATTCCAT- *
13823253-G-GAATGGAATGGAATGGGATGA 11702547-G-GAATGGAATGGAATGGGATGA *
13865055-G-A 11744349-G-A *
13211265-A-G 11055589-A-G *
14659299-C-T 12547364-C-T YY*
14779153-C-A 12667223-C-A YY*
14770339-G-A 12658408-G-A YY*
14732587-G-T 12620655-G-T YY*
14715433-G-T 12603500-G-T Y*
14706601-C-T 12594667-C-T YY*
14695219-T-TA 12583285-T-TA 8×A*
14671437-T-C 12559503-T-C Y*
14658416-T-C 12546481-T-C YY*
14800077-C-T 12688148-C-T YY*
14643113-C-T 12531182-C-T YY*
14583719-G-T 12471919-G-T YY*
14577209-C-T 12465409-C-T YY*
14576881-G-GA 12465081-G-GA 8×A*
14575950-G-A 12464150-G-A YY*
14567184-G-A 12455384-G-A YY*
14567183-T-C 12455383-T-C YY*
28810260-C-T 26664113-C-T *
14808225-T-C 12696296-T-C YY*
14565061-G-A 12453261-G-A Y*
15105871-A-G 12993959-A-G YY*
15332334-C-T 13220452-C-T YY*
15236249-T-C 13124335-T-C Y*
15207533-A-G 13095619-A-G YY*
15188300-G-C 13076386-G-C Y*
15173945-A-G 13062031-A-G YY*
15173423-C-T 13061509-C-T YY*
15166370-G-A 13054456-G-A YY*
15101448-G-T 12989536-G-T Y*
14821385-C-T 12709452-C-T YY*
15098332-A-G 12986420-A-G Y*
14958853-T-C 12846928-T-C YY*
14946249-G-A 12834323-G-A YY*
14943430-T-C 12831504-T-C YY*
14873109-T-C 12761179-T-C YY*
14871798-G-A 12759868-G-A YY*
14855327-A-G 12743393-A-G YY*
14565609-G-A 12453809-G-A Y*
14471523-T-C 12350792-T-C YY*
13887551-T-C 11766845-T-C YY*
13930169-C-A 11809463-C-A Y*
13989221-G-A 11868515-G-A YY*
13989220-T-C 11868514-T-C YY*
13989218-T-C 11868512-T-C YY*
13989216-G-A 11868510-G-A YY*
13953764-A-G 11833058-A-G Y*
13945323-G-A 11824617-G-A YY*
13937171-C-G 11816465-C-G Y*
13930159-C-A 11809453-C-A Y*
14014167-C-T 11893461-C-T Y*
56680282-G-A *
56680326-T-A *
13930153-C-A 11809447-C-A Y*
13922754-C-T 11802048-C-T YY*
13904726-TA-T 11784020-TA-T *
13887580-A-G 11766874-A-G YY*
13887563-G-A 11766857-G-A YY*
13999848-T-C 11879142-T-C Y*
56676518-T-A *
14460808-T-C 12340081-T-C YY*
14293247-A-G 12172541-A-G YY*
14450153-A-AC 12329426-A-AC *
14429845-A-G 12309118-A-G YY*
14423454-T-C 12302729-T-C YY*
14410206-A-G 12289503-A-G YY*
14365453-C-T 12244748-C-T YY*
14334330-G-C 12213624-G-C YY*
14331131-C-CTTTTTTT 12210425-C-CTTTTTTT 25×T*
14221904-T-C 12101198-T-C YY*
14048090-A-G 11927384-A-G YY*
14182864-GA-G 12062158-GA-G *
14165967-C-CA 12045261-C-CA *
14153640-C-T 12032934-C-T Y*
14133130-A-G 12012424-A-G Y*
14111917-C-T 11991211-C-T Y*
14109603-A-G 11988897-A-G YY*
14052663-GTTTGTT-G 11931957-GTTTGTT-G 4×TTTGTT*
13228247-CCCCAGCCCAGTCTCCTGGAGAGATGGACCTGTTCCGCCCACACTCCCAGAGGGGTGGACCTACCCCAGCCCACGCTCCCACAGGGGTGGACCTAT-C 11072571-CCCCAGCCCAGTCTCCTGGAGAGATGGACCTGTTCCGCCCACACTCCCAGAGGGGTGGACCTACCCCAGCCCACGCTCCCACAGGGGTGGACCTAT-C *
13210724-C-T 11055048-C-T *
15443026-A-T 13331146-A-T Y*
7119808-A-G 7251767-A-G Y*
7328094-AGTGATGATAATGGTGATGGTGATGGTGGTGGTGGTGATGGTGATGATG-A 7460053-AGTGATGATAATGGTGATGGTGATGGTGGTGGTGGTGATGGTGATGATG-A *
7328072-CT-C 7460031-CT-C *
7262868-G-GGCT 7394827-G-GGCT *
7236957-A-T 7368916-A-T Y*
7235318-T-C 7367277-T-C YY*
7177306-A-G 7309265-A-G YY*
7144244-C-G 7276203-C-G YY*
7073255-T-C 7205214-T-C YY*
7360591-T-A 7492550-T-A Y*
7046878-C-T 7178837-C-T YY*
7010273-T-C 7142232-T-C YY*
7004955-A-G 7136914-A-G Y*
6997225-A-ATT 7129184-A-ATT 11×T*
6954224-C-T 7086183-C-T YY*
6939794-G-A 7071753-G-A YY*
6934547-A-G 7066506-A-G YY*
7355515-G-A 7487474-G-A YY*
7374045-TCTTTA-T 7506004-TCTTTA-T *
6838003-A-G 6969962-A-G YY*
7586196-T-G 7718155-T-G YY*
8030787-G-A 8162746-G-A FT400417 YY*
8022488-G-T 8154447-G-T YY*
7733477-A-G 7865436-A-G YY*
7720242-T-C 7852201-T-C YY*
7676962-A-G 7808921-A-G YY*
7622637-C-T 7754596-C-T YY*
7617385-A-G 7749344-A-G YY*
7586195-C-T 7718154-C-T YY*
7375249-CT-C 7507208-CT-C 9×T*
7569873-G-A 7701832-G-A YY*
7517871-T-C 7649830-T-C Y*
7510795-T-C 7642754-T-C Y*
7458827-C-T 7590786-C-T IR1_L *
7436159-A-G 7568118-A-G Y*
7405422-T-C 7537381-T-C YY*
7405375-A-G 7537334-A-G YY*
6933028-A-G 7064987-A-G YY*
6793145-C-T 6925104-C-T YY*
8076289-C-T 8208248-C-T YY*
5847750-G-A 5979709-G-A *
5935500-G-A 6067459-G-A *
56868155-C-A *
5920159-G-A 6052118-G-A *
5914901-T-C 6046860-T-C *
5907940-A-G 6039899-A-G *
5893152-A-G 6025111-A-G *
5877213-C-T 6009172-C-T *
5822727-G-A 5954686-G-A *
5946236-CT-C 6078195-CT-C *
5784315-A-T 5916274-A-T *
5714806-A-G 5846765-A-G *
5708051-A-G 5840010-A-G *
5698079-T-TAA 5830038-T-TAA 9×A*
5653833-G-A 5785792-G-A FT364715 *
5607932-G-A 5739891-G-A *
5588698-A-G 5720657-A-G *
5944062-G-A 6076021-G-A *
56859213-TA- 8×A*
6787241-G-A 6919200-G-A YY*
6506448-A-G 6638407-A-G *
6732758-A-T 6864717-A-T YY*
6696712-G-A 6828671-G-A YY*
6688386-C-T 6820345-C-T Y*
6673899-A-G 6805858-A-G YY*
6664921-T-C 6796880-T-C Y*
6621530-C-T 6753489-C-T YY*
6590466-G-A 6722425-G-A *
6370478-G-A 6502437-G-A *
5973068-C-T 6105027-C-T *
6356683-C-T 6488642-C-T *
6137109-A-G 6269068-A-G *
6132499-A-G 6264458-A-G *
6078264-G-T 6210223-G-T *
6022084-A-G 6154043-A-G *
6020873-T-C 6152832-T-C *
6020442-ATGATCT-A 6152401-ATGATCT-A *
8060027-A-G 8191986-A-G YY*
56858331-A-AGTTTATAATGGCATTACTCATAATGGACCCAAGCTTGGAAGAACCT *
56833863-T-C *
9520021-C-T 9682412-C-T *
9911139-T-C 10073530-T-C Y*
9911134-G-C 10073525-G-C FT426495 Y*
9903220-C-T 10065611-C-T Y*
9889658-T-C 10052049-T-C Y*
9874823-G-A 10037214-G-A Y*
9727091-A-G 9889482-A-G IR3_Prx *
9725732-T-A 9888123-T-A IR3_Prx *
9512925-A-G 9675316-A-G *
9911372-C-T 10073763-C-T Y*
9476386-A-G 9638777-A-G *
9456929-A-G 9619320-A-G YY*
9426536-A-G 9588927-A-G YY*
9340831-AACAC-A,AACACACAC 9503222-AACAC-A,AACACACAC 22×AC*
9307880-T-C 9470271-T-C Y*
9307651-T-C 9470042-T-C Y*
9172115-C-T 9334506-C-T Y*
9911365-C-G 10073756-C-G Y*
9924965-C-A 10087356-C-A Y*
9151244-T-C 9313635-T-C Y*
10068927-C-G 10231318-C-G *
56834441-TCCA- *
10781321-CTCAGT-C *
10693131-T-TTCCCC *
10683543-T-C *
10598962-T-C *
56834445-TTCCCTTCCATTCCA- *
10076439-T-C 10238830-T-C *
10068912-T-C 10231303-T-C *
9956748-C-A 10119139-C-A Y*
10068908-T-C 10231299-T-C *
10061831-C-T 10224222-C-T *
10046606-T-C 10208997-T-C *
10041893-T-TA 10204284-T-TA *
10004685-TAC-T 10167076-TAC-T *
10004015-T-C 10166406-T-C Y*
9966556-C-A 10128947-C-A Y*
9151258-C-CAAT 9313649-C-CAAT *
9150995-C-A 9313386-C-A BY37925 Y*
8137234-G-A 8269193-G-A Y*
8408496-A-G 8540455-A-G YY*
8534854-C-T 8666813-C-T YY*
8526834-CT-C 8658793-CT-C *
8478383-A-G 8610342-A-G YY*
8448132-G-A 8580091-G-A YY*
8440529-C-T 8572488-C-T YY*
8438737-C-T 8570696-C-T YY*
8437444-C-CTTT 8569403-C-CTTT 11×T*
8364830-A-G 8496789-A-G YY*
8562418-A-AT 8694377-A-AT 9×T*
8359653-T-G 8491612-T-G YY*
8353255-A-G 8485214-A-G YY*
8351957-G-T 8483916-G-T YY*
8251539-A-C 8383498-A-C YY*
8216024-G-T 8347983-G-T YY*
8185274-A-G 8317233-A-G YY*
8161453-T-C 8293412-T-C YY*
8540143-T-A 8672102-T-A YY*
8570107-A-G 8702066-A-G YY*
9150240-C-A 9312631-C-A BY78563 Y*
8905898-A-AGACAG 9037857-A-AGACAG *
9150233-C-T 9312624-C-T Y*
9149609-G-A 9312000-G-A Y*
56834810-T-A *
9077213-G-A 9239604-G-A *
9074103-T-C 9236494-T-C Y*
8987968-G-A 9150359-G-A *
8969889-A-G 9132280-A-G *
8900750-T-C 9032709-T-C Y*
8570412-T-TA 8702371-T-TA 9×A*
8865657-CT-C 8997616-CT-C *
8858665-T-C 8990624-T-C YY*
56838433-G-C *
8770894-C-G 8902853-C-G YY*
8690497-GC-G 8822456-GC-G *
56838441-A-G *
8621691-G-C 8753650-G-C YY*
8607835-TG-T 8739794-TG-T *
15405674-A-G 13293794-A-G YY*
15518237-T-G 13406357-T-G YY*
15505278-C-T 13393398-C-T YY*
21908799-A-G 19746913-A-G YY*
22167643-GTTTCTTCACATTTTAGGGACTTTT-G 20005757-GTTTCTTCACATTTTAGGGACTTTT-G *
22138219-A-AC 19976333-A-AC *
22111880-A-T 19949994-A-T YY*
28786016-G-A 26639869-G-A *
22094972-A-G 19933086-A-G YY*
22091390-T-C 19929504-T-C YY*
22029469-A-G 19867583-A-G YY*
21897149-GA-G 19735263-GA-G *
22228946-G-A 20067060-G-A DYZ19 *
21882117-CTAGGAAAAAAAAGGTACA-C 19720231-CTAGGAAAAAAAAGGTACA-C *
21833527-T-C 19671641-T-C Y*
21832505-C-T 19670619-C-T Y*
21826792-AT-A 19664906-AT-A 10×T*
21823564-C-CGG 19661678-C-CGG 12×G*
21749678-T-C 19587792-T-C YY*
21680023-C-T 19518137-C-T Y*
22228943-A-G 20067057-A-G FTB39169 DYZ19 *
22287283-G-T 20125397-G-T DYZ19 *
28787373-C-T 26641226-C-T BY151297 *
22463605-T-G 20301719-T-G DYZ19 *
22713787-C-T 20551901-C-T Y*
22712940-G-A 20551054-G-A YY*
22581109-C-T 20419223-C-T YY*
22541318-T-G 20379432-T-G Y*
22531960-C-A 20370074-C-A Y*
22511254-A-T 20349368-A-T DYZ19 *
22463613-T-C 20301727-T-C DYZ19 *
22463603-C-A 20301717-C-A DYZ19 *
22298897-C-T 20137011-C-T DYZ19 *
22442363-T-A 20280477-T-A DYZ19 *
22442359-G-A 20280473-G-A DYZ19 *
22431147-C-A 20269261-C-A DYZ19 *
28783103-T-C 26636956-T-C *
22303219-ACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCATCAGATGTGTATAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCATTTCAAGAATGAAGCTGCAGACCT-A 20141333-ACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCATCAGATGTGTATAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCATTTCAAGAATGAAGCTGCAGACCT-A DYZ19 *
22302202-G-A 20140316-G-A DYZ19 *
22302197-A-T 20140311-A-T DYZ19 *
21558423-A-G 19396537-A-G YY*
21547438-G-A 19385552-G-A YY*
22762155-C-CT 20600269-C-CT 9×T*
21076073-ATTTAATTTAT-A 18914187-ATTTAATTTAT-A *
21161555-T-C 18999669-T-C YY*
21152961-A-G 18991075-A-G Y*
21133485-A-G 18971599-A-G YY*
21121469-A-G 18959583-A-G Y*
28799174-G-C 26653027-G-C *
21076146-GGATTGGAAAAGAGGATGTTT-G 18914260-GGATTGGAAAAGAGGATGTTT-G *
21076089-AGCTATTACTCATCACATTAGGAGAAAGGTCAATTAAAATTTAAACATTCACTTT-A 18914203-AGCTATTACTCATCACATTAGGAGAAAGGTCAATTAAAATTTAAACATTCACTTT-A *
21076057-TATTCACAAAAA-T 18914171-TATTCACAAAAA-T *
21179081-T-C 19017195-T-C YY*
21076049-TAATCCG-T 18914163-TAATCCG-T *
21076020-AAAGAATATAGAAAAAAGATAATATAC-A 18914134-AAAGAATATAGAAAAAAGATAATATAC-A *
21075989-A-G 18914103-A-G YY*
21071771-A-G 18909885-A-G YY*
21050516-G-A 18888630-G-A BY47844 YY8×TTA*
21044090-T-TAA 18882204-T-TAA 14×A*
20811130-T-C 18649244-T-C P4_Gap *
21168574-C-A 19006688-C-A YY*
21184389-T-C 19022503-T-C YY*
28789483-A-T 26643336-A-T *
21393245-G-A 19231359-G-A Y*
21494441-T-C 19332555-T-C YY*
21489630-T-C 19327744-T-C YY*
21476640-CA-C 19314754-CA-C *
21474810-G-A 19312924-G-A Y*
21446739-TGCAAA-T 19284853-TGCAAA-T *
21441375-T-A 19279489-T-A YY*
28791607-T-A 26645460-T-A *
21363090-C-A 19201204-C-A YY16×A*
21205874-A-G 19043988-A-G YY*
21288102-T-C 19126216-T-C YY*
21286830-ATCCAAC-A 19124944-ATCCAAC-A *
21284969-G-A 19123083-G-A YY*
21264007-GGAAGTTAAGA-G 19102121-GGAAGTTAAGA-G *
28792348-C-T 26646201-C-T *
21256598-G-A 19094712-G-A YY*
21216457-C-A 19054571-C-A YY*
22721571-A-G 20559685-A-G YY*
22775130-G-A 20613244-G-A YY*
19885491-T-C 17773611-T-C P5_Prx *
24465131-G-A 22318984-G-A Y*
25546293-A-G 23400146-A-G P1_gr1 *
25546292-C-T 23400145-C-T P1_gr1 *
28715332-G-A 26569185-G-A *
24512115-G-C 22365968-G-C *
24491487-G-C 22345340-G-C *
24483513-CAATAA-C 22337366-CAATAA-C *
24471095-T-C 22324948-T-C Y*
24439622-T-C 22293475-T-C Y*
25546309-C-T 23400162-C-T P1_gr1 *
24427431-A-G 22281284-A-G Y*
24417551-C-T 22271404-C-T Y*
24376538-T-C 22230391-T-C BY149438 Y*
24363919-C-T 22217772-C-T *
24360836-G-A 22214689-G-A *
23962957-T-C 21816810-T-C Y*
23958393-G-A 21812246-G-A Y*
25546302-C-T 23400155-C-T FT461291 P1_gr1 *
25546318-C-T 23400171-C-T P1_gr1 *
23873443-T-C 21711557-T-C Y*
28477519-G-A 26331372-G-A *
28533700-G-T 26387553-G-T FT189710 Y15×T*
28513050-G-A 26366903-G-A *
28501612-C-T 26355465-C-T *
28497370-CT-C 26351223-CT-C *
28493927-AC-A 26347780-AC-A *
28490413-T-A 26344266-T-A *
28640398-G-A 26494251-G-A *
28206572-C-A 26060425-C-A P1_b4 *
25546334-C-T 23400187-C-T P1_gr1 *
27747629-G-A 25601482-G-A P1_Y2 *
27030377-A-G 24884230-A-G P1_r4 *
25546346-T-C 23400199-T-C P1_gr1 *
28713020-T-TC 26566873-T-TC *
25546345-A-T 23400198-A-T P1_gr1 *
25546343-A-T 23400196-A-T P1_gr1 *
25546335-A-G 23400188-A-G P1_gr1 *
23875578-T-C 21713692-T-C *
23834895-C-T 21673009-C-T Y*
22787874-G-T 20625988-G-T YY*
22958627-T-C 20796741-T-C YY*
23282040-C-T 21120154-C-T YY*
23278607-A-G 21116721-A-G YY*
23232733-A-G 21070847-A-G Y*
23197566-A-T 21035680-A-T Y*
23189197-A-G 21027311-A-G Y*
23057264-T-A 20895378-T-A YY*
22985826-T-C 20823940-T-C Y*
22934350-T-C 20772464-T-C YY*
23339577-T-C 21177691-T-C Y*
22922667-CTT-C 20760781-CTT-C 12×T*
22914488-C-T 20752602-C-T YY*
22902471-C-T 20740585-C-T YY*
22830099-T-C 20668213-T-C YY*
22818527-A-G 20656641-A-G YY*
22813339-T-C 20651453-T-C YY*
28753599-G-A 26607452-G-A *
28726697-T-C 26580550-T-C Y*
23351451-CTTGTGAAT-C 21189565-CTTGTGAAT-C *
23819979-T-C 21658093-T-C Y*
23528500-G-A 21366614-G-A YY*
23809414-T-C 21647528-T-C Y*
23776571-T-A 21614685-T-A Y*
23742532-G-T 21580646-G-T *
23739783-C-T 21577897-C-T *
23734569-A-G 21572683-A-G *
23549707-A-G 21387821-A-G YY*
23533464-A-G 21371578-A-G YY*
23526496-G-T 21364610-G-T YY*
23355605-G-T 21193719-G-T Y*
23520576-A-T 21358690-A-T Y*
23517017-C-G 21355131-C-G Y*
23500981-G-T 21339095-G-T YY*
23493467-C-G 21331581-C-G YY*
23437393-C-G 21275507-C-G YY*
23427150-G-C 21265264-G-C YY8×A*
23381618-G-T 21219732-G-T YY*
20802380-T-C 18640494-T-C P4_Gap *
19827489-T-C 17715609-T-C P5_Prx *
28564599-C-A 26418452-C-A *
16750597-T-C 14638717-T-C YY*
17026772-T-C 14914892-T-C Y*
16930569-G-A 14818689-G-A Y*
16914211-A-G 14802331-A-G YY*
16912199-T-C 14800319-T-C YY*
16887604-T-A 14775724-T-A YY*
16851435-GA-G 14739555-GA-G *
16781814-G-T 14669934-G-T YY*
16743471-G-A 14631591-G-A YY*
17050596-T-C 14938716-T-C YY*
16713702-G-T 14601822-G-T YY*
16678125-G-A 14566245-G-A Y*
16536358-C-T 14424478-C-T YY*
16528794-TA-T 14416914-TA-T *
16515285-C-T 14403405-C-T YY*
16507604-A-G 14395724-A-G YY*
16473194-C-T 14361314-C-T YY*
17040657-C-T 14928777-C-T YY*
17090510-T-C 14978630-T-C YY*
16469096-T-C 14357216-T-C Y*
17352659-T-C 15240779-T-C YY*
17478616-A-G 15366736-A-G YY*
17469302-A-G 15357422-A-G YY*
17423407-TA-T 15311527-TA-T *
17414519-A-AT 15302639-A-AT 9×T*
17391192-A-G 15279312-A-G YY*
17385690-G-T 15273810-G-T YY*
17358365-G-A 15246485-G-A YY*
17323635-G-A 15211755-G-A YY*
17108636-T-G 14996756-T-G YY*
17292937-A-G 15181057-A-G YY*
17224296-G-A 15112416-G-A YY*
17181756-C-T 15069876-C-T YY*
17177400-C-T 15065520-C-T YY*
17169855-G-T 15057975-G-T YY*
17135053-T-C 15023173-T-C YY*
17115915-G-C 15004035-G-C YY*
16472520-G-A 14360640-G-A YY*
16461024-C-T 14349144-C-T YY*
17505161-T-C 15393281-T-C Y*
15610306-G-A 13498426-G-A YY*
15872509-G-A 13760629-G-A YY*
15865046-G-A 13753166-G-A YY*
15850533-T-C 13738653-T-C YY*
15840449-A-G 13728569-A-G YY*
15804820-C-T 13692940-C-T Y*
15639718-T-C 13527838-T-C Y*
15628473-T-C 13516593-T-C Y*
15589797-T-C 13477917-T-C YY*
5585266-C-A 5717225-C-A *
15565808-A-G 13453928-A-G YY*
15552188-T-C 13440308-T-C YY*
15544376-C-T 13432496-C-T YY*
15536005-T-G 13424125-T-G YY*
15524960-A-G 13413080-A-G YY*
15518913-A-G 13407033-A-G YY*
15518239-A-AAACTCATGGTGCTAAGGAAACAAAAGGAAGCTCTAAACAGAGTAAAAG 13406359-A-AAACTCATGGTGCTAAGGAAACAAAAGGAAGCTCTAAACAGAGTAAAAG *
15877171-T-A 13765291-T-A YY*
15881635-T-C 13769755-T-C YY*
16440473-CA-C 14328593-CA-C *
16289175-G-T 14177295-G-T YY*
16438362-A-G 14326482-A-G YY*
16406974-T-C 14295094-T-C YY*
16388096-G-A 14276216-G-A YY*
16373212-G-T 14261332-G-T YY*
16360260-C-T 14248380-C-T YY*
16352146-A-G 14240266-A-G Y*
16303201-G-A 14191321-G-A YY*
16241673-T-A 14129793-T-A YY*
15984556-A-G 13872676-A-G YY*
16218764-T-C 14106884-T-C YY*
16210457-A-G 14098577-A-G Y*
16192783-A-G 14080903-A-G YY*
16089373-G-A 13977493-G-A Y*
16072561-G-T 13960681-G-T Y*
16062849-A-G 13950969-A-G Y*
16021094-T-C 13909214-T-C Y*
17492990-T-TC 15381110-T-TC *
17555734-C-T 15443854-C-T YY*
19542692-A-T 17430812-A-T YY*
18903184-A-G 16791304-A-G YY*
19055867-T-C 16943987-T-C Y*
19021184-T-C 16909304-T-C YY*
19008522-C-A 16896642-C-A YY*
19001953-G-T 16890073-G-T YY*
18998171-T-C 16886291-T-C YY*
18964254-C-T 16852374-C-T YY*
18913715-C-T 16801835-C-T YY*
18902658-G-T 16790778-G-T YY*
19109096-A-G 16997216-A-G YY*
18902655-A-ATGCACCCTTGTTTATGTGTGACTGGCTCTCTC 16790775-A-ATGCACCCTTGTTTATGTGTGACTGGCTCTCTC *
18898025-T-C 16786145-T-C YY*
18871257-G-A 16759377-G-A YY*
18819414-G-A 16707534-G-A YY*
18755401-A-G 16643521-A-G YY*
18738827-G-A,GTA 16626947-G-A,GTA 10×TA*
18703927-G-GGA 16592047-G-GGA 9×GA*
19066247-C-T 16954367-C-T YY*
19110460-C-T 16998580-C-T YY*
18618932-G-A 16507052-G-A YY*
19350506-G-T 17238626-G-T YY*
19530098-CAGCTTTTATATTT-C 17418218-CAGCTTTTATATTT-C *
19484516-A-G 17372636-A-G Y*
19476049-C-T 17364169-C-T YY*
19457131-T-A 17345251-T-A YY*
19424140-C-A 17312260-C-A Y*
19397950-G-A 17286070-G-A YY*
19351896-G-T 17240016-G-T Y*
19347014-A-G 17235134-A-G YY*
19114331-G-A 17002451-G-A YY*
19332454-G-A 17220574-G-A BY128279 YY*
19311394-A-G 17199514-A-G YY*
19253820-C-G 17141940-C-G Y*
19253797-G-T 17141917-G-T Y*
19200191-A-G 17088311-A-G YY*
19184202-G-A 17072322-G-A Y*
19170536-C-G 17058656-C-G Y*
28799180-A-C 26653033-A-C *
18590770-G-A 16478890-G-A YY*
17565724-T-C 15453844-T-C YY*
17780683-T-C 15668803-T-C YY*
17959600-T-C 15847720-T-C YY*
17938142-T-C 15826262-T-C YY*
17901428-A-G 15789548-A-G Y*
17885230-T-C 15773350-T-C Y*
17870617-A-G 15758737-A-G YY*
17848861-C-A 15736981-C-A YY*
17840877-A-G 15728997-A-G YY*
17753877-A-G 15641997-A-G YY*
28805580-A-C 26659433-A-C *
17696303-A-G 15584423-A-G YY*
17665244-G-GTCTATCTCTGACGCAGAGTTCAGCTATAAGACTATAACACCAGACAACTATACTTCAAGCGAAGAGACACAAGTGAATACTAAAACCACAAAGTCAAAGTAAGCAGAGCCTCTAAA 15553364-G-GTCTATCTCTGACGCAGAGTTCAGCTATAAGACTATAACACCAGACAACTATACTTCAAGCGAAGAGACACAAGTGAATACTAAAACCACAAAGTCAAAGTAAGCAGAGCCTCTAAA *
17634798-CT-C 15522918-CT-C *
17607951-C-T 15496071-C-T YY*
17585814-CA-C 15473934-CA-C *
17574408-AT-A 15462528-AT-A 9×T*
17568642-A-G 15456762-A-G YY*
17996507-G-A 15884627-G-A P7_Gap Y*
18039211-A-G 15927331-A-G YY*
28799184-G-C 26653037-G-C *
18131933-C-G 16020053-C-G Y*
18572224-T-C 16460344-T-C YY*
18549288-C-T 16437408-C-T FTB49067 Y*
18405157-T-A 16293277-T-A P6_Gap *
18397692-A-G 16285812-A-G P6_Gap *
18268105-A-G 16156225-A-G *
18248455-T-C 16136575-T-C Y*
28805069-A-G 26658922-A-G *
18131359-T-C 16019479-T-C Y*
18045900-GA-G 15934020-GA-G *
18131352-T-C 16019472-T-C Y*
18128904-T-TGAAACGAAAGATGAAAAATGCCAAGATATTTAACTATAGTATTTTTATTTTAGATGTTATTCTACTGTTTATAC 16017024-T-TGAAACGAAAGATGAAAAATGCCAAGATATTTAACTATAGTATTTTTATTTTAGATGTTATTCTACTGTTTATAC *
18121038-T-A 16009158-T-A Y*
18057922-T-C 15946042-T-C Y*
28805480-C-A 26659333-C-A BY227411 *
18051797-G-A 15939917-G-A YY*
28805489-A-G 26659342-A-G *
18050251-T-C 15938371-T-C YY*
13700750-T-TATGGAATGGAATGGAATGGAATGGA 11545074-T-TATGGAATGGAATGGAATGGAATGGA *
5388859-A-G 5520818-A-G *
5549998-AT-A 5681957-AT-A *
5452626-CT-C 5584585-CT-C 11×T*
13726217-A-G 11570541-A-G *
56689060-G-A *
56838438-A-C *
5728904-CAGAG-C 5860863-CAGAG-C 12×AG*
13712273-G-A 11556597-G-A *
18471858-TACAC-T 16359978-TACAC-T P6_Dst 12×AC*
7990632-CT-C 8122591-CT-C 8×T*
28791343-G-T 26645196-G-T *
28791447-T-A 26645300-T-A *
28791400-A-T 26645253-A-T *
16082660-A-C 13970780-A-C Y*
22510110-A-T 20348224-A-T DYZ19 *
13468248-C-T 11312572-C-T *
13468226-G-T 11312550-G-T *
13465126-A-T 11309450-A-T *
13465120-G-C 11309444-G-C *
13499276-T-C 11343600-T-C *
18856212-C-A 16744332-C-A YY*
58916312-C-T 56674559-G-A *
17920835-G-A 15808955-G-A MF1880 YY*
13725644-G-A 11569968-G-A *
9888968-G-T 10051359-G-T Y*
10781314-C-A *
7326034-GT-G 7457993-GT-G 10×T*
13488939-C-A 11333263-C-A *
28720132-C-CTTT 26573985-C-CTTT 24×T*
56838419-C-T *
28784476-C-T 26638329-C-T *
22580068-C-A 20418182-C-A YY19×T*
10781298-C-A *
9618240-T-C 9780631-T-C IR3_Prx *
56850186-G-C *
56850168-T-A *
14938282-C-T 12826357-C-T Z28585 YY*
5978898-CA-C 6110857-CA-C *
56850856-C-A *
15917633-A-AT 13805753-A-AT 9×T*
58916305-T-G 56674566-A-C *
22255090-G-C 20093204-G-C BY214249 DYZ19 *
7964566-A-G 8096525-A-G YY*
21410399-G-GA 19248513-G-GA 9×A*
13380592-T-A 11224916-T-A *
8888540-CA-C 9020499-CA-C 9×A*
17824037-T-C 15712157-T-C Y*
13713253-C-G 11557577-C-G *
13706793-G-A 11551117-G-A FT449245 *
13468489-T-A 11312813-T-A *
13468463-C-T 11312787-C-T *
13468457-G-A 11312781-G-A *
13474399-T-A 11318723-T-A *
58862570-A-T 56728301-T-A *
22509080-T-A 20347194-T-A DYZ19 *
58880323-C-T 56710548-G-A *
23121025-G-A 20959139-G-A YY*
26500451-AACACACACACAC-A 24354304-AACACACACACAC-A P1_Y1 23×AC*
58856656-AATTCCATTCC-A 56734195-AGAATGGAATG-A *
13451915-C-T 11296239-C-T *
13468237-T-G 11312561-T-G *
13474408-G-A 11318732-G-A *
21283921-C-CA 19122035-C-CA 8×A*
13454903-A-T 11299227-A-T *
28795834-ATGAAT-A 26649687-ATGAAT-A *
18659020-A-ATG 16547140-A-ATG 8×TG*
58856701-C-T 56734170-G-A *
58883953-G-A 56706918-C-T *
22460494-G-A 20298608-G-A FGC70906 DYZ19 *
22230221-A-T 20068335-A-T DYZ19 *
28789451-A-T 26643304-A-T *
58856460-T-A 56734411-A-T *
58856427-A-G 56734444-T-C *
58856457-A-G 56734414-T-C *
17526031-TA-T 15414151-TA-T 9×A*
22254484-G-T 20092598-G-T DYZ19 *
58819868-A-G 56771003-T-C *
22509135-A-T 20347249-A-T DYZ19 *
13480204-T-C 11324528-T-C *
13474456-C-G 11318780-C-G *
58856446-T-A 56734425-A-T *
56850863-C-A *
10683544-G-C *
13468575-G-A 11312899-G-A *
3399082-C-CT 3531041-C-CT 8×T*
13693599-G-A 11537923-G-A *
13388239-G-C 11232563-G-C *
13388232-A-G 11232556-A-G *
13388227-A-G 11232551-A-G *
56871623-T-TAAAAAA 9×A*
23035980-GA-G 20874094-GA-G 9×A*
27647554-A-G 25501407-A-G P1_Y2 *
19524660-G-A 17412780-G-A YY*
28795861-A-C 26649714-A-C BY55580 *
4839160-G-GA 4971119-G-GA 9×A*
10781303-C-A *
10781299-C-T *
13483336-G-A 11327660-G-A *
6468779-G-T 6600738-G-T *
13474563-T-C 11318887-T-C *
59030478-AAAAC-A,AAAACAAAC 56884331-AAAAC-A,AAAACAAAC 6×AAAC*
22510141-T-A 20348255-T-A DYZ19 *
13474393-G-C 11318717-G-C *
22611917-C-A 20450031-C-A YY*
13722798-G-A 11567122-G-A *
13486875-C-T 11331199-C-T *
13464967-C-T 11309291-C-T BY153331 *
3866259-GAA-G 3998218-GAA-G 13×A*
5470826-CT-C 5602785-CT-C *
22509081-G-GT 20347195-G-GT DYZ19 *
22204984-G-T 20043098-G-T Y*
13466351-C-A 11310675-C-A *
28812952-C-T 26666805-C-T *
22509479-G-A 20347593-G-A DYZ19 *
28812931-G-A 26666784-G-A *
13474546-C-T 11318870-C-T *
13474530-A-G 11318854-A-G *
14934306-C-A 12822371-C-A YY15×T*
13713034-C-T 11557358-C-T *
24428841-A-G 22282694-A-G BY42436 Y*
5631285-ATT-A 5763244-ATT-A 13×T*
23875750-A-G 21713864-A-G *
13474512-C-A 11318836-C-A *
13468327-C-A 11312651-C-A *
19547250-G-A 17435370-G-A FTB40641 YY*
23628599-A-C 21466713-A-C YY*
13474446-T-C 11318770-T-C *
13469090-C-T 11313414-C-T *
13465072-G-A 11309396-G-A *
6779652-AC-A 6911611-AC-A 8×C*
22444201-T-A 20282315-T-A DYZ19 *
13721226-G-A 11565550-G-A *
13483395-A-T 11327719-A-T *
28578515-G-T 26432368-G-T *
13474291-T-A 11318615-T-A *
13809281-C-A 11688575-C-A *
10693142-C-T *
22228951-G-A 20067065-G-A BY213301 DYZ19 *
22228941-A-T 20067055-A-T BY14787 DYZ19 *
13474507-C-A 11318831-C-A *
28784469-T-C 26638322-T-C *
3641849-A-AT 3773808-A-AT 10×T*
13712337-G-A 11556661-G-A *
58862985-A-T 56727886-T-A *
13474449-G-T 11318773-G-T *
13469424-A-T 11313748-A-T *
13242900-A-T 11087224-A-T *
18518268-G-GTTTT 16406388-G-GTTTT P6_Dst 24×T*
13720809-A-C 11565133-A-C *
13689241-G-A 11533565-G-A *
13469165-T-A 11313489-T-A *
13469163-C-G 11313487-C-G *
13469142-G-C 11313466-G-C *
13469097-T-G 11313421-T-G *
9931405-C-G 10093796-C-G FT202847 Y*
13712712-C-T 11557036-C-T *
14607780-C-A 12495982-C-A Y*
19017591-T-C 16905711-T-C Y*
28811085-G-A 26664938-G-A A4531 *
17349441-C-A 15237561-C-A YY*
13690464-G-C 11534788-G-C BY48173 *
13488663-G-C 11332987-G-C *
14464376-G-A 12343649-G-A YY*
13730401-A-T 11574725-A-T *
58985209-C-T 56839062-C-T *
13489618-CA-C 11333942-CA-C *
28791292-G-T 26645145-G-T *
13275119-A-G 11119443-A-G *
13386219-C-T 11230543-C-T *
13383329-T-C 11227653-T-C *
13383296-G-C 11227620-G-C Z39757 *
13349184-T-C 11193508-T-C *
13315206-G-C 11159530-G-C *
13279556-T-C 11123880-T-C *
13279552-G-T 11123876-G-T *
13261840-A-C 11106164-A-C *
13389065-CTTAGAGTGAGACT-C 11233389-CTTAGAGTGAGACT-C *
13241224-G-A 11085548-G-A *
5966753-A-C 6098712-A-C *
5842408-G-A 5974367-G-A *
5490904-G-A 5622863-G-A FGC81628 *
5459235-G-T 5591194-G-T *
4328613-G-A 4460572-G-A *
3377471-G-C 3509430-G-C *
13388218-A-C 11232542-A-C *
13434676-C-A 11279000-C-A *
3081622-A-T 3213581-A-T *
23100309-G-A 20938423-G-A Y*
59033638-C-A 56887491-C-A *
59030975-G-T 56884828-G-T *
59030915-T-A 56884768-T-A *
59030836-AT-A 56884689-AT-A *
59021218-C-T 56875071-C-T *
59006232-A-G 56860085-A-G *
28795770-G-A 26649623-G-A *
23100301-C-T 20938415-C-T Y*
13447132-C-T 11291456-C-T *
22509031-A-T 20347145-A-T DYZ19 *
22463642-A-G 20301756-A-G DYZ19 *
19042179-C-A 16930299-C-A Y17×A*
14667840-AC-A 12555906-AC-A *
13569087-T-C 11413411-T-C *
13569052-T-C 11413376-T-C *
13506539-G-T 11350863-G-T *
13485381-C-A 11329705-C-A *
3292498-C-T 3424457-C-T *
3081568-T-G 3213527-T-G *
23456824-A-AT 21294938-A-AT 8×T*
28808749-A-T 26662602-A-T PF1351 *
22255438-C-A 20093552-C-A BY52183 DYZ19 *
13484023-G-A 11328347-G-A *
28799186-A-G 26653039-A-G *
13694666-G-T 11538990-G-T *
58912536-C-T 56678335-G-A *
6603191-A-G 6735150-A-G *
28588053-C-T 26441906-C-T *
28808737-T-C 26662590-T-C PF1350 *
22463609-C-G 20301723-C-G BY3226BY28642 DYZ19 *
9968253-C-T 10130644-C-T Y*
9968251-C-T 10130642-C-T BY46993 Y*
25037867-G-GA 22891720-G-GA g1 11×A*
13451920-G-T 11296244-G-T *
13692879-T-TGAATG 11537203-T-TGAATG 4×GAATG*
8896019-CCA-C 9027978-CCA-C *
28786002-AGTGAC-A 26639855-AGTGAC-A *
9177967-A-T 9340358-A-T Y*
13706091-G-T 11550415-G-T *
13709044-C-G 11553368-C-G *
3072673-CAT-C 3204632-CAT-C *
9188597-T-A 9350988-T-A Y*
58884333-C-A 56706538-G-T *
2945865-C-A 3077824-C-A *
58874797-T-A 56716074-A-T *
28790892-T-A 26644745-T-A *
28800107-G-A 26653960-G-A *
27637187-TTC-T 25491040-TTC-T P1_Y2 *
28794511-G-A 26648364-G-A *
58872545-C-A 56718326-G-T *
13473774-T-G 11318098-T-G *
58872543-T-A 56718328-A-T *
58855913-A-T 56734958-T-A *
4740566-G-GA 4872525-G-GA 9×A*
7483638-T-TA 7615597-T-TA IR1_L 23×A*
22339013-A-C 20177127-A-C DYZ19 *
9968223-C-T 10130614-C-T Y*
9968221-C-T 10130612-C-T Y*
26262476-A-ATG 24116329-A-ATG P1_Y1 18×TG*
9181098-TATAC-T 9343489-TATAC-T *
3172631-G-A 3304590-G-A *
22509112-C-T 20347226-C-T DYZ19 *
13472015-G-A 11316339-G-A *
13489605-C-T 11333929-C-T *
9304636-C-T 9467027-C-T Y*
13471917-G-A 11316241-G-A *
13470512-G-C 11314836-G-C *
17900528-CT-C 15788648-CT-C 10×T*
58916324-T-C 56674547-A-G S3134 *
58916340-T-C 56674531-A-G *
22473433-G-T 20311547-G-T BY222914 DYZ19 *
58856299-C-A 56734572-G-T *
21298718-T-TA 19136832-T-TA 9×A*
23860084-CA-C 21698198-CA-C 9×A*
28791576-CAAAGGAGACA-C 26645429-CAAAGGAGACA-C *
19108769-AT-A 16996889-AT-A FT6631FT6631 10×T*
58985783-A-C 56839636-A-C *
58858826-T-A 56732045-A-T *
58884552-C-T 56706319-G-A *
58856285-T-A 56734586-A-T *
22287300-T-G 20125414-T-G BY32756 DYZ19 *
58867051-T-G 56723820-A-C *
28800099-A-T 26653952-A-T *
13478334-C-G 11322658-C-G *
13705276-G-A 11549600-G-A *
22507865-T-C 20345979-T-C DYZ19 *
13691344-G-C 11535668-G-C *
22440920-A-T 20279034-A-T BY218934 DYZ19 *
58866686-C-G 56724185-G-C *
58882418-G-A 56708453-C-T *
58884142-C-A 56706729-G-T *
13489624-C-A 11333948-C-A *
58903883-T-A 56686988-A-T *
13726727-T-C 11571051-T-C *
58872496-C-T 56718375-G-A *
13488633-C-A 11332957-C-A *
58855211-C-A 56735660-G-T *
9328907-T-C 9491298-T-C Y*
7601435-A-AT 7733394-A-AT 10×T*
13483993-G-T 11328317-G-T *
58874760-A-T 56716111-T-A *
18615962-G-T 16504082-G-T YY*
4421864-T-G 4553823-T-G *
13358764-A-G 11203088-A-G *
13692732-C-T 11537056-C-T *
13689704-C-G 11534028-C-G *
13473936-G-A 11318260-G-A *
13465087-G-C 11309411-G-C *
13442817-A-T 11287141-A-T *
13423949-G-A 11268273-G-A *
13383797-C-A 11228121-C-A *
13275426-T-G 11119750-T-G *
13705746-G-A 11550070-G-A *
13273197-A-C 11117521-A-C *
13270742-A-G 11115066-A-G *
13259301-GC-G 11103625-GC-G *
13240141-G-A 11084465-G-A FTB74734 *
10041882-A-C 10204273-A-C *
9941192-A-G 10103583-A-G Y*
7258755-C-CAA 7390714-C-CAA 25×A*
5847226-G-T 5979185-G-T *
13694650-T-A 11538974-T-A BY44585BY44611 *
13710467-G-T 11554791-G-T *
9186646-CTTG-C 9349037-CTTG-C *
28792783-C-G 26646636-C-G *
59006193-G-A 56860046-G-A *
59005952-G-A 56859805-G-A *
58980537-TTCCAC-T 56834390-TTCCAC-T *
28813005-T-A 26666858-T-A *
28812994-G-C 26666847-G-C A4541 *
28795745-C-A 26649598-C-A BY192350 *
28792786-C-A 26646639-C-A *
28657166-TAC-T 26511019-TAC-T *
13715149-T-A 11559473-T-A BY40430 *
22442360-T-A 20280474-T-A BY10774 DYZ19 *
22298900-A-T 20137014-A-T BY216717 DYZ19 *
22163646-ATG-A 20001760-ATG-A *
18738825-A-G 16626945-A-G ZS1586 YY*
16302678-C-T 14190798-C-T Y95906 YY*
14846598-C-T 12734664-C-T YY*
13722924-A-C 11567248-A-C *
13718370-C-G 11562694-C-G *
22423269-T-A 20261383-T-A DYZ19 *
6440192-C-CT 6572151-C-CT 8×T*
5545527-AT-A 5677486-AT-A *
13488825-GCGT-G 11333149-GCGT-G *
3387219-C-T 3519178-C-T *
56833893-G-GTCCACT *
56830357-C-CCATTT *
56830355-C-CTT *
56830353-C-CATA *
13712715-A-G 11557039-A-G *
13706089-G-C 11550413-G-C *
13488821-C-CACT 11333145-C-CACT *
2696631-A-G 2828590-A-G YY*
13465030-A-T 11309354-A-T *
3255814-G-GA 3387773-G-GA 10×A*
13711760-AATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGC-A 11556084-AATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGC-A *
22287266-C-T 20125380-C-T DYZ19 *
56734287-A-T *
13722800-A-C 11567124-A-C *
13722788-G-A 11567112-G-A *
3558263-G-T 3690222-G-T *
2710419-T-C 2842378-T-C YY*
13693609-G-A 11537933-G-A *
2935138-G-A 3067097-G-A *
3140739-TA-T 3272698-TA-T *
3117822-A-G 3249781-A-G *
3107044-C-T 3239003-C-T *
3043500-T-C 3175459-T-C *
3035590-T-C 3167549-T-C *
3000353-T-C 3132312-T-C *
2999891-A-G 3131850-A-G *
2913058-A-T 3045017-A-T Y*
2711626-AGCCG-A 2843585-AGCCG-A *
2877112-A-G 3009071-A-G YY*
2865127-T-C 2997086-T-C YY*
2862487-T-C 2994446-T-C YY*
2791286-GCTGATAAGA-G 2923245-GCTGATAAGA-G *
2781816-C-T 2913775-C-T YY*
2761573-T-C 2893532-T-C YY*
2757724-C-A 2889683-C-A YY*
2721539-G-T 2853498-G-T YY*
13693611-A-C 11537935-A-C *
13483457-A-T 11327781-A-T *
3251408-C-T 3383367-C-T *
13470093-A-G 11314417-A-G *
28784678-T-C 26638531-T-C *
11291125-C- *
9931390-AT-A 10093781-AT-A *
17143891-A-ATTTTTT 15032011-A-ATTTTTT 35×T*
13483396-C-G 11327720-C-G *
56827687-T-TGCCATCCGATTC *
13484033-G-A 11328357-G-A *
13470076-C-G 11314400-C-G *
13447591-T-C 11291915-T-C *
13470068-C-T 11314392-C-T *
11333287-A- *
13204361-ATGATG-A 11048685-ATGATG-A *
13204356-TGGTG-T 11048680-TGGTG-T *
15068340-A-C 12956431-A-C YY*
17951326-C-G 15839446-C-G YY*
56830816-ACTCC-A *
28811053-C-CA 26664906-C-CA *
11293362-CACTGCATTCCATTCCAAT- *
10693838-C-A *
13868888-A-T 11748182-A-T *
10693830-TTTCAA-T *
56878253-G-GCA,GCACACACACACA 9×CA*
17059058-A-G 14947178-A-G Y*
56834605-C-CTCAACTTTAA *
13868899-T-C 11748193-T-C *
13868896-G-A 11748190-G-A BY91723 *
13868890-AG-A 11748184-AG-A *
13868881-GAAC-G 11748175-GAAC-G *
11293417-C- *
13868868-ACGGAT-A 11748162-ACGGAT-A *
13706562-T-A 11550886-T-A *
22505741-T-A 20343855-T-A DYZ19 *
13721161-G-T 11565485-G-T *
28810261-G-C 26664114-G-C *
28805466-TGGAGC-T 26659319-TGGAGC-T *
56736278-G-A *
11293419-T- *
3181437-AT-A 3313396-AT-A 9×T*
3259066-T-C 3391025-T-C *
13447543-C-A 11291867-C-A *
4856769-A-G 4988728-A-G *
5046059-A-G 5178018-A-G *
5044092-T-C 5176051-T-C *
5034937-T-C 5166896-T-C *
5015576-T-C 5147535-T-C *
4986247-A-G 5118206-A-G *
4924407-A-G 5056366-A-G *
4890510-A-G 5022469-A-G *
4856644-A-G 4988603-A-G *
5087418-G-A 5219377-G-A *
4759932-T-C 4891891-T-C *
4752346-C-G 4884305-C-G *
4749588-T-C 4881547-T-C *
4730502-A-AT 4862461-A-AT *
4730451-T-C 4862410-T-C *
4730243-T-C 4862202-T-C *
4714429-A-G 4846388-A-G *
5080190-C-T 5212149-C-T *
5090000-T-C 5221959-T-C *
4703384-C-T 4835343-C-T *
28790905-C-A 26644758-C-A FT11485A4498 *
5533877-C-T 5665836-C-T *
5514767-C-T 5646726-C-T *
5512678-C-T 5644637-C-T *
5439433-T-C 5571392-T-C *
5436523-C-T 5568482-C-T *
5425054-C-T 5557013-C-T *
5415572-T-A 5547531-T-A *
5350060-A-T 5482019-A-T *
5122772-C-T 5254731-C-T *
5274379-T-C 5406338-T-C *
5256912-C-A 5388871-C-A *
5231608-G-T 5363567-G-T *
5223065-GC-G 5355024-GC-G *
5209899-A-G 5341858-A-G *
5195236-C-T 5327195-C-T *
5137418-C-T 5269377-C-T *
5129161-G-A 5261120-G-A *
4705999-G-A 4837958-G-A *
4692128-T-C 4824087-T-C *
3280648-T-A 3412607-T-A *
3536164-T-C 3668123-T-C *
3850205-G-T 3982164-G-T *
3844716-T-C 3976675-T-C *
3827799-C-T 3959758-C-T FTA55314 *
3816359-A-G 3948318-A-G *
3804294-T-C 3936253-T-C *
3699554-A-G 3831513-A-G *
3585233-C-T 3717192-C-T *
3522781-A-G 3654740-A-G *
3961623-C-T 4093582-C-T *
3507322-G-A 3639281-G-A *
3500887-C-T 3632846-C-T *
3403380-G-A 3535339-G-A *
3392781-T-C 3524740-T-C *
3378687-T-C 3510646-T-C *
3361870-T-C 3493829-T-C *
3305273-A-G 3437232-A-G *
3292606-A-G 3424565-A-G *
3901436-G-A 4033395-G-A *
3998276-A-G 4130235-A-G *
4532517-C-T 4664476-C-T *
4333484-G-T 4465443-G-T *
4527325-C-T 4659284-C-T *
4527195-A-G 4659154-A-G *
4460009-A-ATATC 4591968-A-ATATC *
4450289-G-T 4582248-G-T *
4440489-T-C 4572448-T-C *
4384718-C-A 4516677-C-A FT341460 *
4363321-G-A 4495280-G-A *
4322146-A-G 4454105-A-G *
4005429-G-A 4137388-G-A *
4318413-T-C 4450372-T-C *
4311737-C-T 4443696-C-T *
4301118-G-A 4433077-G-A *
4285573-A-G 4417532-A-G *
4201711-C-T 4333670-C-T *
4152991-A-T 4284950-A-T *
4128189-C-T 4260148-C-T *
4056777-A-G 4188736-A-G *
9995930-T-G 10158321-T-G Y*
13447538-C-A 11291862-C-A *
13228241-G-A 11072565-G-A *
10677319-TCCTTC-T *
13306738-C-T 11151062-C-T *
13887553-A-G 11766847-A-G YY*
28794151-T-A 26648004-T-A *
13454853-A-T 11299177-A-T *
13722838-G-T 11567162-G-T *
13722837-G-T 11567161-G-T *
28588004-G-A 26441857-G-A *
28812906-G-A 26666759-G-A *
5350061-G-T 5482020-G-T *
56884769-G-A *
13425807-G-A 11270131-G-A *
13474496-G-A 11318820-G-A *
56861812-CAAAAAAAAA-C,CAAAAAAAA 26×A*
13471830-A-G,T 11316154-A-G,T *
25546285-T-G 23400138-T-G P1_gr1 *
28813748-G-A 26667601-G-A *
13315172-G-A 11159496-G-A *
13476441-A-G 11320765-A-G *
13704959-A-C 11549283-A-C *
22272029-C-A 20110143-C-A DYZ19 *
13846487-A-G 11725781-A-G *
13846463-T-A 11725757-T-A *
13930171-CAAA-C,CAA 11809465-CAAA-C,CAA 21×A*
13887562-T-C 11766856-T-C YY*
13887559-G-A 11766853-G-A YY*
13887558-T-C 11766852-T-C YY*
8268381-C-CT 8400340-C-CT 9×T*
13846448-T-C 11725742-T-C *
13709481-G-C 11553805-G-C *
13846435-G-C 11725729-G-C *
13470461-G-T 11314785-G-T *
23505495-C-CA,CAAA 21343609-C-CA,CAAA 23×A*
22255075-A-T 20093189-A-T DYZ19 *
22505765-T-A 20343879-T-A DYZ19 *
2999232-A-T 3131191-A-T *
13292797-CT-C 11137121-CT-C *
56734154-T-C *
13851111-G-A 11730405-G-A *
13687961-G-A 11532285-G-A *
22040668-T-C 19878782-T-C YY*
16010265-C-A 13898385-C-A Y*
10004716-C-T 10167107-C-T Y*
21448423-CT-C 19286537-CT-C 8×T*
56838417-C-A *
28818376-G-C 26672229-G-C *
8296901-T-C 8428860-T-C YY*
28818372-A-T 26672225-A-T *
58906634-A-C 56684237-T-G *
19154357-G-A 17042477-G-A BY191510 YY*
9911380-T-C 10073771-T-C Y*
13458751-C-CATCGA 11303075-C-CATCGA *
13457973-C-CTCCGTTCCGT 11302297-C-CTCCGTTCCGT 7×TCCGT*
21107314-A-G 18945428-A-G Y*
16631767-G-T 14519887-G-T YY*
7142093-A-G 7274052-A-G Y*
18608340-A-AT 16496460-A-AT 9×T*
13442780-C-T 11287104-C-T *
4195537-CT-C 4327496-CT-C 10×T*
14567186-C-G 12455386-C-G YY*
13489253-GGA-G 11333577-GGA-G *
13519152-T-C 11363476-T-C *
13706130-A-C 11550454-A-C *
13287971-C-CTCTCTCTCTA 11132295-C-CTCTCTCTCTA *
56680293-C-G *
14565060-A-C 12453260-A-C Y*
13442791-G-A 11287115-G-A *
13442781-T-G 11287105-T-G *
56845068-T-G *
22366412-C-A 20204526-C-A DYZ19 *
13573986-A-G 11418310-A-G *
13338261-A-C 11182585-A-C *
13573941-A-G 11418265-A-G *
13573897-A-G 11418221-A-G *
13573885-G-C 11418209-G-C *
13465058-G-T 11309382-G-T *
5350059-G-T 5482018-G-T *
13476436-C-G 11320760-C-G *
4474248-TTA-T 4606207-TTA-T 8×TA*
13468923-C-T 11313247-C-T *
56734139-T-A *
16327128-A-AT 14215248-A-AT 8×T*
4431198-TTG-T 4563157-TTG-T *
13711747-TGGAAC-T 11556071-TGGAAC-T *
13473116-G-T 11317440-G-T *
13473105-A-T 11317429-A-T *
13458720-C-G 11303044-C-G *
28791431-TGTAAGGGA-T 26645284-TGTAAGGGA-T *
28791428-GAA-G 26645281-GAA-G *
28791415-T-C 26645268-T-C *
16013006-T-C 13901126-T-C Y*
13447515-T-A 11291839-T-A *
15243048-T-C 13131134-T-C Y*
13447504-C-CATTCT 11291828-C-CATTCT *
13389093-G-GA 11233417-G-GA *
56839067-AAAC-A *
13723463-A-C 11567787-A-C *
13706155-G-A 11550479-G-A *
13443187-C-A 11287511-C-A *
3712813-T-TGAGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGAGAGAGAGAGAGAGAGAGAGAGAGAGA *
13708695-T-A 11553019-T-A *
15243087-C-G 13131173-C-G Y*
13704861-G-A 11549185-G-A *
13465117-C-A 11309441-C-A *
4431197-A-AAG 4563156-A-AAG *
13720810-A-C 11565134-A-C *
13709404-T-A 11553728-T-A *
13463310-G-A 11307634-G-A *
13204374-TTATGATAATGGTGGTGATGGTG-T 11048698-TTATGATAATGGTGGTGATGGTG-T *
56710650-A-G *
56710642-C-A *
13463941-G-A 11308265-G-A *
28785970-G-A 26639823-G-A *
13451165-T-C,TCCACTGCACTACACTCCAC 11295489-T-C,TCCACTGCACTACACTCCAC *
13451163-T-C,TCCA 11295487-T-C,TCCA *
22463610-G-A 20301724-G-A FT219322 DYZ19 *
22713504-C-T 20551618-C-T FT292315 Y*
13691798-T-TATGGA,TGGA 11536122-T-TATGGA,TGGA *
56876124-CAAAAAAAAAAAAAAAAAAAA-C 50×A*
56711018-A-T *
28785974-T-C 26639827-T-C *
17349430-ACAGTCTCTG-A 15237550-ACAGTCTCTG-A *
13434645-A-G 11278969-A-G *
13283402-T-C 11127726-T-C *
13700749-C-CAA 11545073-C-CAA *
13707121-T-G 11551445-T-G *
13707076-T-TG 11551400-T-TG *
13458744-T-G 11303068-T-G *
13447606-T-C 11291930-T-C *
13447601-A-C 11291925-A-C *
4636108-T-A,A 4768067-T-A,A *
22437620-GACCTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCACATAAGTCCAGAGTTTCTTCCTTCTGTCCGGTTTATGGTCTTGCTCACTTCAAGAATGAAGCTGCAT-G 20275734-GACCTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCACATAAGTCCAGAGTTTCTTCCTTCTGTCCGGTTTATGGTCTTGCTCACTTCAAGAATGAAGCTGCAT-G DYZ19 *
13478339-G-GCTC 11322663-G-GCTC *
17645152-A-AGACAACTTCAGATTGTACCATCTACGCTTTTGTTGGTACTGCAATTCTCGCCATCTCTCTTGTCGTGGCGATGTATGTAGGCAATGACTTTCACCAAAGTCTGTTTGTCGAGTCAATCATCTTTGT 15533272-A-AGACAACTTCAGATTGTACCATCTACGCTTTTGTTGGTACTGCAATTCTCGCCATCTCTCTTGTCGTGGCGATGTATGTAGGCAATGACTTTCACCAAAGTCTGTTTGTCGAGTCAATCATCTTTGT *
28793702-T-C 26647555-T-C *
13723116-T-C 11567440-T-C BY36920 *
13723114-A-T 11567438-A-T *
13723113-G-T 11567437-G-T *
13506505-G-A 11350829-G-A *
13389101-T-A 11233425-T-A *
28790907-G-A 26644760-G-A *
10004706-A-G 10167097-A-G Y*
13707133-G-C 11551457-G-C *
56734060-G-T *
13434638-C-T 11278962-C-T *
3363217-A-G 3495176-A-G *
13434613-A-T 11278937-A-T *
13301857-G-C 11146181-G-C *
13450907-A-C 11295231-A-C *
56771416-A-T *
28802597-T-A 26656450-T-A *
14286362-AAG-A 12165656-AAG-A 8×AG*
13261497-G-A 11105821-G-A *
22479421-G-C 20317535-G-C DYZ19 *
56734061-G-T *
16024305-CA-C 13912425-CA-C 10×A*
13868779-T-TCAAAA 11748073-T-TCAAAA *
13868765-GGAACA-G 11748059-GGAACA-G *
28811106-T-C 26664959-T-C *
13712703-C-T 11557027-C-T *
9984323-G-A 10146714-G-A Y*
9984228-C-T 10146619-C-T Y*
56830821-AC-A *
56886095-C-CAAAAAAAAAAAA 11×A*

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 4173316160750103544438352532
Used in age calculations16160750103544438352532
Counts of SNPs425319
Variant counts last updated 2022-11-23 03:04:15.



Big Tree Main Page