Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > ZZ12 > BY3332 > BY22163 > BY22194 > BY35076 > BY35082 > BY207979

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-Dante
56001801068696
22996969-GAT-G 20835083-GAT-G 21×AT+
22502987-GTGTC-G 20341101-GTGTC-G DYZ19 +
4818228-G-T 4950187-G-T A3672 +
24386994-A-ATATATATATATCTCCTATATATATCCTATATATATATCTCCTATATATATCC 22240847-A-ATATATATATATCTCCTATATATATCCTATATATATATCTCCTATATATATCC +
56750689-T-C +
10655435-C-A +
56737300-AAT-A +
56737277-T-A +
7166601-C-CATATAT 7298560-C-CATATAT 20×AT+
7536337-C-CA 7668296-C-CA 28×A+
7297726-C-G 7429685-C-G FT362041 Y+
10924725-T-C +
10687512-C-T +
10677588-CACCAA-C +
6723742-C-G 6855701-C-G Y+
10899782-C-A +
19099486-A-AT 16987606-A-AT 8×T+
16723421-C-CTGTT 14611541-C-CTGTT 4×TGTT+
13549110-C-T 11393434-C-T +
24879654-G-C 22733507-G-C g1 +
56699595-T-A +
26299668-G-T 24153521-G-T P1_Y1 +
10747843-G-A +
26561352-G-T 24415205-G-T P1_g2 +
58853571-TCCA-T 56737296-ATGG-A +
21579266-ATGGGC-A 19417380-ATGGGC-A +
10693838-C-A +
17781483-T-TTTTTATTTTATTTTA 15669603-T-TTTTTATTTTATTTTA 16×TTTTA+
5147441-C-CAA 5279400-C-CAA 30×A+
58866259-A-T 56724612-T-A +
10693830-TTTCAA-T +
10747841-A-C +
28778852-C-CTTTT 26632705-C-CTTTT 33×T+
10747838-C-A +
56851597-A-G +
28489509-G-A 26343362-G-A +
15820178-AGATAAAT-A 13708298-AGATAAAT-A *
15890997-G-T 13779117-G-T Y*
15826060-A-G 13714180-A-G YY*
15882886-C-A 13771006-C-A Y*
15842686-G-T 13730806-G-T YY*
15886462-T-C 13774582-T-C Y*
15866074-G-T 13754194-G-T YY*
15884112-C-A 13772232-C-A Y*
15875795-G-T 13763915-G-T YY*
15797840-G-A 13685960-G-A Y*
15818375-C-T 13706495-C-T YY*
15734760-A-G 13622880-A-G YY*
15681042-G-T 13569162-G-T BY181611 Y*
15683141-G-T 13571261-G-T Y*
15697683-C-T 13585803-C-T YY*
15707334-C-A 13595454-C-A YY*
15720816-G-T 13608936-G-T YY*
15722645-G-A 13610765-G-A YY*
15731814-G-T 13619934-G-T YY*
15733139-C-G 13621259-C-G YY*
15734830-G-A 13622950-G-A YY*
15817309-T-C 13705429-T-C YY*
15756236-C-A 13644356-C-A YY*
15756239-G-T 13644359-G-T FT86896 YY*
15763499-T-C 13651619-T-C Y*
15767844-C-A 13655964-C-A YY*
15781735-A-G 13669855-A-G YY*
15781911-A-G 13670031-A-G YY*
15805205-G-T 13693325-G-T Y*
15814047-C-T 13702167-C-T YY*
15900260-C-A 13788380-C-A YY*
15946579-G-T 13834699-G-T YY*
15904466-G-T 13792586-G-T YY*
16248799-C-T 14136919-C-T YY*
16205885-C-A 14094005-C-A YY*
16228845-CT-C 14116965-CT-C *
16229824-AT-A 14117944-AT-A *
16231033-T-C 14119153-T-C YY*
16240190-C-T 14128310-C-T YY*
16242819-C-A 14130939-C-A YY*
16244405-G-T 14132525-G-T YY*
16248462-A-G 14136582-A-G YY*
16251710-C-T 14139830-C-T YY*
16181398-A-G 14069518-A-G Y*
16264939-A-G 14153059-A-G YY*
16266874-G-T 14154994-G-T Y*
16280670-A-G 14168790-A-G YY*
16305275-G-A 14193395-G-A YY*
16307127-G-A 14195247-G-A YY*
16314545-C-A 14202665-C-A YY*
16324455-T-C 14212575-T-C YY*
16357157-G-T 14245277-G-T YY*
16197835-T-C 14085955-T-C YY*
16080309-C-A 13968429-C-A Y*
15908046-C-G 13796166-C-G YY*
16004476-A-T 13892596-A-T Y*
15931181-C-A 13819301-C-A YY*
15941775-G-T 13829895-G-T YY*
15671388-G-A 13559508-G-A Y*
15950788-C-A 13838908-C-A YY*
15958177-T-C 13846297-T-C Y*
15979232-C-A 13867352-C-A YY*
15981997-T-C 13870117-T-C YY*
15993319-A-G 13881439-A-G YY*
16006314-C-A 13894434-C-A YY*
16070323-C-T 13958443-C-T Y*
16009935-T-C 13898055-T-C Y*
16012336-T-C 13900456-T-C Y*
16014850-T-C 13902970-T-C Y*
16024175-C-A 13912295-C-A Y*
16035221-A-T 13923341-A-T Y*
16047662-G-T 13935782-G-T Y*
16055995-G-T 13944115-G-T Y*
16058470-G-A 13946590-G-A YY*
16066749-C-A 13954869-C-A Y*
15680127-C-T 13568247-C-T Y*
15636879-C-A 13524999-C-A Y*
15669399-G-T 13557519-G-T Y*
15266214-C-T 13154303-C-T YY*
15231591-C-T 13119677-C-T Y*
15236295-G-A 13124381-G-A Y*
15238859-G-T 13126945-G-T Y*
15242276-C-A 13130362-C-A Y*
15244320-A-G 13132406-A-G Y*
15244595-C-A 13132681-C-A Y*
15255210-G-T 13143296-G-T YY*
15255286-G-T 13143372-G-T YY*
15257490-C-A 13145574-C-A YY*
15268621-C-A 13156710-C-A YY*
15223541-C-A 13111627-C-A Y*
15269673-G-A 13157762-G-A YY*
15276040-C-A 13164129-C-A YY*
15284191-G-A 13172290-G-A Y*
15291621-C-A 13179720-C-A Y*
15306342-C-A 13194444-C-A YY*
15315614-G-T 13203720-G-T YY*
15343060-G-T 13231179-G-T YY*
15351037-G-T 13239156-G-T YY*
15363460-G-A 13251580-G-A YY*
15231078-C-A 13119164-C-A Y*
15219565-G-T 13107651-G-T Y*
15377168-G-T 13265288-G-T Y*
15140905-T-C 13028992-T-C YY*
15007064-C-A 12895149-C-A YY*
15020978-T-C 12909067-T-C YY*
15030007-C-A 12918095-C-A YY*
15056586-A-G 12944678-A-G YY*
15062168-C-A 12950260-C-A YY*
15101987-G-T 12990075-G-T Y*
15119655-A-G 13007742-A-G Y*
15119791-G-T 13007878-G-T Y*
15140902-TC-T 13028989-TC-T *
15146272-C-T 13034359-C-T YY*
15217954-A-G 13106040-A-G Y*
15147208-C-T 13035295-C-T Y*
15148729-G-T 13036816-G-T Y*
15153475-A-G 13041562-A-G YY*
15154656-G-T 13042743-G-T YY*
15160274-C-CA 13048360-C-CA *
15168596-C-A 13056682-C-A Y*
15170004-GT-G 13058090-GT-G *
15174588-C-T 13062674-C-T YY*
15195647-T-C 13083733-T-C YY*
15372882-A-G 13261002-A-G YY*
15381392-T-C 13269512-T-C YY*
15657302-G-T 13545422-G-T YY*
15599634-C-T 13487754-C-T Y*
15567482-T-C 13455602-T-C YY*
15573442-C-A 13461562-C-A YY*
15574609-G-T 13462729-G-T YY*
15581981-T-C 13470101-T-C YY*
15583060-G-T 13471180-G-T YY*
15588396-T-C 13476516-T-C YY*
15593274-C-CAAA 13481394-C-CAAA 23×A*
15598812-T-C 13486932-T-C Y*
15599029-T-C 13487149-T-C Y*
15601775-G-T 13489895-G-T YY*
15553985-T-C 13442105-T-C YY*
15616721-A-G 13504841-A-G YY*
15619070-G-T 13507190-G-T YY*
15620671-G-A 13508791-G-A YY*
16362374-C-T 14250494-C-T YY*
15638749-C-T 13526869-C-T Y*
15640789-T-G 13528909-T-G Y*
15644213-G-T 13532333-G-T Y*
15652058-C-A 13540178-C-A FTB45534 YY*
15652756-G-A 13540876-G-A YY*
15562679-G-T 13450799-G-T YY*
15549477-G-T 13437597-G-T YY*
15384179-T-G 13272299-T-G YY*
15462242-C-G 13350362-C-G YY*
15385284-TA-T 13273404-TA-T *
15404166-TA-T 13292286-TA-T *
15412303-G-T 13300423-G-T YY*
15412330-G-A 13300450-G-A YY*
15414392-C-A 13302512-C-A YY*
15415844-A-T 13303964-A-T YY*
15431177-G-T 13319297-G-T YY*
15447540-C-A 13335660-C-A YY*
15462039-T-C 13350159-T-C YY*
15476604-CTT-C 13364724-CTT-C *
15545775-T-C 13433895-T-C YY*
15484997-A-G 13373117-A-G YY*
15486159-C-T 13374279-C-T YY*
15490147-TTCAAACATCCAACTGATATG-T 13378267-TTCAAACATCCAACTGATATG-T *
15506235-C-T 13394355-C-T YY*
15510383-G-T 13398503-G-T YY*
15520606-G-T 13408726-G-T YY*
15526608-A-G 13414728-A-G YY*
15539234-A-G 13427354-A-G YY*
15545742-C-CA 13433862-C-CA *
16358723-C-T 14246843-C-T YY*
13142268-C-T 10631754-C-T *
16362814-T-C 14250934-T-C YY*
17345793-T-C 15233913-T-C FTB48839 YY*
17280321-T-C 15168441-T-C YY*
17285013-G-C 15173133-G-C YY*
17286366-T-C 15174486-T-C YY*
17311762-A-G 15199882-A-G YY*
17323376-G-T 15211496-G-T YY*
17325727-G-T 15213847-G-T YY*
17325999-C-A 15214119-C-A YY*
17339243-G-A 15227363-G-A YY*
17349288-C-A 15237408-C-A YY*
17272953-C-A 15161073-C-A YY*
17368900-A-T 15257020-A-T YY*
17377864-G-T 15265984-G-T Y*
17378979-C-A 15267099-C-A Y*
17382578-G-A 15270698-G-A YY*
17403763-C-T 15291883-C-T YY*
17412614-C-A 15300734-C-A YY*
17421668-G-T 15309788-G-T YY*
17421856-A-T 15309976-A-T YY*
17443910-A-G 15332030-A-G YY*
17277350-G-T 15165470-G-T YY*
17266536-G-T 15154656-G-T Y*
17459319-G-T 15347439-G-T YY*
17154903-T-C 15043023-T-C Y*
17117531-C-A 15005651-C-A YY*
17120454-C-A 15008574-C-A YY*
17121080-A-G 15009200-A-G YY*
17131113-G-A 15019233-G-A YY*
17133500-C-A 15021620-C-A YY*
17146462-G-T 15034582-G-T YY*
17152371-T-C 15040491-T-C YY*
17154302-T-C 15042422-T-C Y*
17154569-C-A 15042689-C-A Y*
17195192-C-T 15083312-C-T YY*
17255961-T-C 15144081-T-C YY*
17196321-A-G 15084441-A-G YY*
17197923-C-A 15086043-C-A YY*
17199698-C-A 15087818-C-A YY*
17201197-C-A 15089317-C-A YY*
17206491-G-T 15094611-G-T YY*
17212662-G-T 15100782-G-T YY*
17222976-G-C 15111096-G-C YY*
17226753-C-T 15114873-C-T Y*
17249144-A-G 15137264-A-G Y*
17450891-T-C 15339011-T-C Y*
17459900-G-T 15348020-G-T YY*
17107487-C-T 14995607-C-T YY*
17784762-T-C 15672882-T-C Y*
17760768-CT-C 15648888-CT-C 8×T*
17762637-T-C 15650757-T-C YY*
17765566-A-G 15653686-A-G YY*
17765980-T-C 15654100-T-C YY*
17767560-C-A 15655680-C-A YY*
17775862-G-T 15663982-G-T Y*
17781456-T-C 15669576-T-C YY*
17782783-C-A 15670903-C-A Y*
17784768-G-A 15672888-G-A Y*
17742808-G-T 15630928-G-T YY*
17787106-CAAAAAAAA-C,CAAAAAA 15675226-CAAAAAAAA-C,CAAAAAA 19×A*
17790495-G-T 15678615-G-T YY*
17805437-G-T 15693557-G-T YY*
17825685-G-T 15713805-G-T Y*
17836540-G-T 15724660-G-T Y*
17856569-G-T 15744689-G-T Y*
17856862-G-A 15744982-G-A Y*
17857757-C-T 15745877-C-T Y*
17870990-T-C 15759110-T-C YY*
17755841-A-G 15643961-A-G YY*
17718630-A-T 15606750-A-T YY*
17476297-G-T 15364417-G-T YY*
17587474-T-C 15475594-T-C YY*
17476584-T-C 15364704-T-C YY*
17486641-C-T 15374761-C-T YY*
17494953-C-A 15383073-C-A YY*
17508959-T-C 15397079-T-C YY*
17519643-G-T 15407763-G-T Y*
17541378-A-G 15429498-A-G Y*
17543090-A-C 15431210-A-C Y*
17556299-C-A 15444419-C-A YY*
17567023-C-A 15455143-C-A YY*
17597372-G-T 15485492-G-T YY*
17708595-C-A 15596715-C-A YY*
17636302-C-A 15524422-C-A Y*
17658656-C-T 15546776-C-T YY*
17663475-A-G 15551595-A-G YY*
17665244-G-GTCTATCTCTGACGCAGAGTTCAGCTATAAGACTATAACACCAGACAACTATACTTCAAGCGAAGAGACACAAGTGAATACTAAAACCACAAAGTCAAAGTAAGCA 15553364-G-GTCTATCTCTGACGCAGAGTTCAGCTATAAGACTATAACACCAGACAACTATACTTCAAGCGAAGAGACACAAGTGAATACTAAAACCACAAAGTCAAAGTAAGCA *
17670425-T-A 15558545-T-A YY*
17673346-A-G 15561466-A-G YY*
17689206-C-A 15577326-C-A YY*
17699137-G-T 15587257-G-T Y*
17700315-A-G 15588435-A-G Y*
17112994-A-G 15001114-A-G YY*
17086843-T-TC 14974963-T-TC *
16375098-T-C 14263218-T-C YY*
16585085-G-A 14473205-G-A YY*
16528804-G-T 14416924-G-T YY*
16532532-G-A 14420652-G-A YY*
16545445-A-G 14433565-A-G YY*
16554756-G-T 14442876-G-T YY*
16556166-C-A 14444286-C-A YY*
16564597-C-A 14452717-C-A YY*
16572505-C-A 14460625-C-A YY*
16580061-C-G 14468181-C-G YY*
16595631-TA-T 14483751-TA-T *
16509329-A-G 14397449-A-G YY*
16600851-T-C 14488971-T-C YY*
16631579-C-A 14519699-C-A YY*
16644045-G-T 14532165-G-T YY*
16655049-G-T 14543169-G-T YY*
16665258-C-T 14553378-C-T Y*
16685929-G-T 14574049-G-T Y*
16698296-GA-G 14586416-GA-G *
16705616-C-A 14593736-C-A Y*
16705727-G-C 14593847-G-C Y*
16527989-T-C 14416109-T-C YY*
16497101-A-G 14385221-A-G YY*
16721680-G-C 14609800-G-C Y*
16435337-A-G 14323457-A-G YY*
16381902-A-G 14270022-A-G Y*
16382781-G-T 14270901-G-T Y*
16386380-C-T 14274500-C-T YY*
16398738-G-T 14286858-G-T Y*
16406373-A-T 14294493-A-T YY*
16409092-G-A 14297212-G-A YY*
16414037-T-C 14302157-T-C YY*
16416489-G-A 14304609-G-A YY*
14992199-G-T 12880284-G-T YY*
16443904-T-A 14332024-T-A YY*
16495938-GTTTGTTTTCCTTTCATTCATTTCACT-G 14384058-GTTTGTTTTCCTTTCATTCATTTCACT-G *
16456237-G-T 14344357-G-T YY*
16464441-G-T 14352561-G-T YY*
16472713-G-T 14360833-G-T YY*
16476626-A-G 14364746-A-G YY*
16480843-T-C 14368963-T-C Y*
16492633-C-A 14380753-C-A YY*
16493071-ATTTCATATT-A 14381191-ATTTCATATT-A *
16493988-C-A 14382108-C-A YY*
16495758-C-T 14383878-C-T YY*
16715490-G-T 14603610-G-T YY*
16723079-G-T 14611199-G-T Y*
17061683-A-G 14949803-A-G Y*
16976880-C-A 14865000-C-A Y*
16913179-T-C 14801299-T-C YY*
16916707-G-A 14804827-G-A YY*
16917416-C-A 14805536-C-A YY*
16917774-G-T 14805894-G-T YY*
16935891-T-C 14824011-T-C YY*
16942067-G-C 14830187-G-C YY*
16954376-C-A 14842496-C-A YY*
16955576-G-A 14843696-G-A YY*
16964666-C-A 14852786-C-A YY*
16985782-G-T 14873902-G-T YY*
16903461-G-T 14791581-G-T YY*
16990888-T-TAA 14879008-T-TAA 11×A*
17000096-T-C 14888216-T-C Y*
17010105-A-G 14898225-A-G YY*
17010210-A-G 14898330-A-G YY*
17016775-T-C 14904895-T-C YY*
17032283-T-C 14920403-T-C YY*
17035103-C-A 14923223-C-A YY*
17047876-C-T 14935996-C-T YY*
17057525-T-C 14945645-T-C YY*
16912839-G-C 14800959-G-C YY*
16886269-G-T 14774389-G-T Y*
16732070-G-T 14620190-G-T YY*
16795421-CACAGGGTAGGCTGCATT-C 14683541-CACAGGGTAGGCTGCATT-C *
16733210-A-G 14621330-A-G YY*
16735279-C-A 14623399-C-A YY*
16750815-T-C 14638935-T-C YY*
16767964-A-G 14656084-A-G YY*
16771406-C-A 14659526-C-A YY*
16776452-A-G 14664572-A-G YY*
16776790-C-A 14664910-C-A YY*
16777066-T-C 14665186-T-C YY*
16792226-T-C 14680346-T-C YY*
16812814-A-G 14700934-A-G YY*
16869380-C-G 14757500-C-G YY*
16816922-T-C 14705042-T-C YY*
16830567-A-G 14718687-A-G YY*
16847804-A-G 14735924-A-G Y*
16850695-C-A 14738815-C-A YY*
16850938-T-C 14739058-T-C YY*
16853462-G-A 14741582-G-A YY*
16862344-C-T 14750464-C-T FT424175 YY*
16867861-C-T 14755981-C-T YY*
16868184-TA-T 14756304-TA-T *
14998058-A-G 12886143-A-G YY*
14902079-G-A 12790146-G-A YY*
14988989-G-T 12877055-G-T YY*
11307550-T- *
13462332-CCCA-C 11306656-CCCA-C *
13462579-C-T 11306903-C-T BY85624 *
13462580-C-T 11306904-C-T *
13462588-C-A 11306912-C-A *
13462608-A-C 11306932-A-C *
13462646-G-A 11306970-G-A *
13462687-G-T 11307011-G-T *
13462701-C-G 11307025-C-G *
13463774-G-C 11308098-G-C *
13462323-C-T 11306647-C-T *
13465030-A-T 11309354-A-T *
13465992-AC-A 11310316-AC-A *
13466922-T-A 11311246-T-A *
13466932-G-C 11311256-G-C *
13468304-TC-T 11312628-TC-T *
13468307-C-CT 11312631-C-CT *
13468317-T-TC 11312641-T-TC *
13468325-A-T 11312649-A-T *
13468328-C-T 11312652-C-T *
13462327-C-CTCA 11306651-C-CTCA *
13460610-ACATCACCTGGGTGATTACTGCAGAGATATGTCACAAAGTCCCCATACACAGAGCCTAGACAAGAGTCC-A 11304934-ACATCACCTGGGTGATTACTGCAGAGATATGTCACAAAGTCCCCATACACAGAGCCTAGACAAGAGTCC-A *
13468583-GCA-G 11312907-GCA-G *
13375955-C-G 11220279-C-G *
13357787-C-A 11202111-C-A *
13358556-G-T 11202880-G-T *
13360595-C-A 11204919-C-A *
13361563-T-C 11205887-T-C *
13363420-C-A 11207744-C-A *
13364745-C-A 11209069-C-A *
13369853-A-T 11214177-A-T *
13375052-C-A 11219376-C-A *
13383307-A-G 11227631-A-G *
13456821-ACATTCCATTCCATTCTATTCCATTCCATTCCATTCCATTC-A 11301145-ACATTCCATTCCATTCTATTCCATTCCATTCCATTCCATTC-A *
13397078-G-T 11241402-G-T *
13402782-G-T 11247106-G-T *
13407141-C-CTT 11251465-C-CTT 13×T*
13431248-C-A 11275572-C-A *
13434187-T-C 11278511-T-C *
13444356-A-G 11288680-A-G *
13454859-T-G 11299183-T-G *
13454861-C-T 11299185-C-T *
13454862-C-G 11299186-C-G *
13468582-A-T 11312906-A-T *
13468594-G-C 11312918-G-C *
13357058-G-T 11201382-G-T *
13693154-G-A 11537478-G-A *
13646912-G-T 11491236-G-T *
13651148-G-T 11495472-G-T *
13658332-G-T 11502656-G-T *
13665071-A-G 11509395-A-G *
13671751-G-T 11516075-G-T *
13689474-T-C 11533798-T-C *
13690122-C-G 11534446-C-G *
13691914-A-T 11536238-A-T *
13693518-G-T 11537842-G-T *
13618732-G-T 11463056-G-T *
13693612-T-TGGA 11537936-T-TGGA *
13693622-T-TGGAA 11537946-T-TGGAA *
13693624-G-GGAATGC 11537948-G-GGAATGC *
13694572-G-C 11538896-G-C *
13694627-G-T 11538951-G-T BY88883 *
13697005-G-T 11541329-G-T *
13697010-G-T 11541334-G-T *
13697195-A-G 11541519-A-G *
13700765-A-AAT 11545089-A-AAT *
13644937-C-A 11489261-C-A FTB47442 *
13617892-G-T 11462216-G-T *
13474542-A-AGAACCC 11318866-A-AGAACCC *
13498946-G-C 11343270-G-C *
13479171-T-C 11323495-T-C *
13487751-CCA-C 11332075-CCA-C *
13488413-C-G 11332737-C-G *
13488597-C-G 11332921-C-G *
13488821-C-CACT 11333145-C-CACT *
13488825-GCGT-G 11333149-GCGT-G *
11333152-T- *
11333943-ACCCCCACCACCACCCACCACCC- *
13489866-A-C 11334190-A-C *
13508573-C-A 11352897-C-A *
13615974-G-T 11460298-G-T *
13508836-A-T 11353160-A-T *
13514476-T-C 11358800-T-C *
13540880-C-A 11385204-C-A *
13543450-A-G 11387774-A-G *
13544194-C-A 11388518-C-A *
13550985-T-C 11395309-T-C *
13558951-G-T 11403275-G-T *
13576356-C-A 11420680-C-A *
13610807-C-A 11455131-C-A *
13357060-G-T 11201384-G-T *
13348023-G-GTTTTA 11192347-G-GTTTTA *
13701922-CA-C 11546246-CA-C *
9955314-A-G 10117705-A-G Y*
9918466-T-A 10080857-T-A Y*
9919236-G-T 10081627-G-T Y*
9919865-A-G 10082256-A-G Y*
9925162-T-C 10087553-T-C Y*
9925171-A-G 10087562-A-G Y*
9937022-G-C 10099413-G-C Y*
9940625-A-ACACCTCTTCTTAACTTAGAATATCGTTATATAATCTTTATTAGATATTAGTAGAGGCCCT 10103016-A-ACACCTCTTCTTAACTTAGAATATCGTTATATAATCTTTATTAGATATTAGTAGAGGCCCT *
9942800-TGTC-T 10105191-TGTC-T *
9957357-G-C 10119748-G-C Y*
9912489-C-T 10074880-C-T Y*
9957736-T-A 10120127-T-A Y*
9962477-A-G 10124868-A-G Y*
9964344-TGC-T 10126735-TGC-T *
9964347-TC-T 10126738-TC-T *
9964374-T-A 10126765-T-A Y*
9971346-C-A 10133737-C-A Y*
9974223-T-TCTTC,TTTC 10136614-T-TCTTC,TTTC *
9982715-T-C 10145106-T-C Y*
9987642-G-T 10150033-G-T Y*
9916156-G-T 10078547-G-T Y*
9912085-C-T 10074476-C-T Y*
9992534-G-T 10154925-G-T Y*
9807022-G-A 9969413-G-A YY*
9674379-C-A 9836770-C-A IR3_Prx *
9732055-G-T 9894446-G-T IR3_Prx *
9734499-G-T 9896890-G-T IR3_Prx *
9747888-C-A 9910279-C-A *
9762236-C-A 9924627-C-A Y*
9776287-G-T 9938678-G-T Y*
9776526-A-G 9938917-A-G Y*
9786883-G-T 9949274-G-T Y*
9828254-C-A 9990645-C-A YY*
9905656-C-A 10068047-C-A Y*
9831693-G-A 9994084-G-A YY*
9864219-A-G 10026610-A-G YY*
9882218-G-T 10044609-G-T YY*
9882254-G-T 10044645-G-T YY*
9884274-T-C 10046665-T-C YY*
9892030-T-C 10054421-T-C YY*
9893430-CA-C 10055821-CA-C *
9899258-A-G 10061649-A-G Y*
9902476-G-T 10064867-G-T Y*
9988423-C-A 10150814-C-A Y*
9996331-G-T 10158722-G-T Y*
13336872-G-T 11181196-G-T *
13266890-T-C 11111214-T-C *
10693444-T-TC,TC *
10905912-C-A *
10946104-C-A *
10983731-C-G *
13196261-T-A 11040585-T-A *
13222515-G-T 11066839-G-T *
13233159-C-A 11077483-C-A *
13248719-G-T 11093043-G-T *
13268907-G-T 11113231-G-T *
10693398-C-T,T *
13279998-CAAAAAAA-C,CAAAAAA 11124322-CAAAAAAA-C,CAAAAAA 26×A*
13298081-G-T 11142405-G-T *
13299529-C-CAA 11143853-C-CAA 9×A*
13300146-C-A 11144470-C-A *
13308257-G-T 11152581-G-T *
13313177-T-C 11157501-T-C *
13317918-G-A 11162242-G-A *
13317923-T-C 11162247-T-C *
13327400-A-T 11171724-A-T *
10693433-T-C,C *
10654725-C-T *
10015340-C-T 10177731-C-T Y*
10075885-C-T 10238276-C-T *
10039706-C-A 10202097-C-A *
10040601-T-C 10202992-T-C *
10041915-T-A 10204306-T-A *
10043292-T-C 10205683-T-C *
10045458-G-T 10207849-G-T *
10048564-C-A 10210955-C-A *
10056098-C-A 10218489-C-A *
10064904-C-T 10227295-C-T *
10066530-TAGTTTCTA-T 10228921-TAGTTTCTA-T *
10078822-C-A 10241213-C-A *
10647791-A-G *
10083629-C-T 10246020-C-T *
10093753-C-A 10256144-C-A *
10094196-G-A 10256587-G-A *
10094625-A-T 10257016-A-T *
10598992-G-C *
10625927-G-T *
10626560-T-C *
10631818-T-C *
10647782-T-C *
13700766-GGC-G 11545090-GGC-G *
13702492-C-A 11546816-C-A *
14987577-C-T 12875643-C-T YY*
14628742-A-G 12516810-A-G YY*
14583817-G-T 12472017-G-T YY*
14584488-C-A 12472688-C-A YY*
14592075-T-C 12480275-T-C YY*
14602946-G-T 12491148-G-T YY*
14603024-G-T 12491226-G-T YY*
14604015-G-T 12492217-G-T YY*
14605570-G-T 12493772-G-T Y*
14628267-C-A 12516335-C-A YY*
14637670-ATG-A 12525739-ATG-A *
14565364-C-A 12453564-C-A Y*
14647384-C-A 12535449-C-A YY*
14648151-C-T 12536216-C-T YY*
14649906-T-C 12537971-T-C BY23844 YY*
14649908-CG-C 12537973-CG-C *
14656965-G-T 12545030-G-T YY*
14657209-C-A 12545274-C-A YY*
14668982-T-C 12557048-T-C Y*
14685638-A-T 12573704-A-T Y*
14687940-A-G 12576006-A-G Y*
14579652-G-T 12467852-G-T YY*
14565345-C-A 12453545-C-A Y*
14692632-G-A 12580698-G-A YY*
14505083-G-A 12393288-G-A YY*
14429436-TGGTGTAACATGGAATGCTTTG-T 12308709-TGGTGTAACATGGAATGCTTTG-T *
14429464-G-A 12308737-G-A YY*
14452413-G-T 12331686-G-T YY*
14463891-T-TA 12343164-T-TA *
14465221-G-T 12344494-G-T YY*
14476247-ACCTT-A 12355516-ACCTT-A *
14499288-C-A 12387493-C-A YY*
14504031-G-A 12392236-G-A YY*
14519079-C-A 12407280-C-A YY*
14561142-G-T 12449343-G-T YY*
14521729-A-G 12409930-A-G YY*
14521912-C-A 12410113-C-A YY*
14524396-G-T 12412597-G-T Y*
14527720-C-G 12415921-C-G YY*
14541551-C-G 12429752-C-G YY*
14542535-A-G 12430736-A-G YY*
14543377-A-G 12431578-A-G YY*
14547070-T-C 12435271-T-C YY*
14558215-T-C 12446416-T-C Y*
14690516-G-T 12578582-G-T Y*
14695580-C-A 12583646-C-A Y*
14423784-T-C 12303059-T-C YY*
14915947-C-A 12804014-C-A YY*
14863844-A-G 12751910-A-G YY*
14863909-C-A 12751975-C-A YY*
14873743-G-T 12761813-G-T YY*
14883643-T-C 12771709-T-C YY*
14886845-C-A 12774911-C-A YY*
14892423-T-C 12780489-T-C YY*
14897724-A-AT 12785790-A-AT *
17874460-T-C 15762580-T-C YY*
14915969-G-T 12804036-G-T BY98461 YY*
14854596-G-T 12742662-G-T YY*
14928781-C-T 12816846-C-T FT226716 YY*
14939144-G-T 12827218-G-T YY*
14939657-G-A 12827731-G-A YY*
12842478-C-CTTTT 14×T*
14955581-A-G 12843656-A-G YY*
14955592-C-A 12843667-C-A YY*
14957658-C-A 12845733-C-A YY*
14971661-T-C 12859736-T-C YY*
14986134-C-T 12874202-C-T YY*
14855271-C-A 12743337-C-A YY*
14844517-C-A 12732583-C-A YY*
14719994-T-C 12608062-T-C Y*
14777552-G-C 12665621-G-C YY*
14727125-C-A 12615193-C-A YY*
14735828-A-T 12623896-A-T YY*
14747077-TC-T 12635146-TC-T *
14751652-CT-C 12639721-CT-C *
14751975-C-A 12640044-C-A YY*
14754780-G-A 12642849-G-A YY*
14768518-G-A 12656587-G-A YY*
14776685-T-C 12664754-T-C YY*
14776967-A-G 12665036-A-G YY*
14779188-C-G 12667258-C-G YY*
14841086-A-G 12729153-A-G YY*
14803891-G-T 12691962-G-T YY*
14809168-T-TTA 12697239-T-TTA *
14809170-C-CCGGCGGCCAACAACAACGGGTATTCCTGGCCCGTGCCCTGGT 12697241-C-CCGGCGGCCAACAACAACGGGTATTCCTGGCCCGTGCCCTGGT *
14809173-A-AGGACGGAG 12697244-A-AGGACGGAG *
14809176-A-ATCTATTTCATGGACGAACCGTTCAAGG 12697247-A-ATCTATTTCATGGACGAACCGTTCAAGG *
14825985-C-A 12714052-C-A YY*
14838119-G-T 12726186-G-T YY*
14841060-C-A 12729127-C-A YY*
14841081-A-G 12729148-A-G YY*
14428800-TTTCCC-T 12308075-TTTCCC-T *
14421642-G-T 12300917-G-T Y*
13705070-T-C 11549394-T-C *
13896202-A-G 11775496-A-G Y*
13845774-T-C 11725068-T-C *
13849806-G-T 11729100-G-T *
13850036-G-T 11729330-G-T *
13864601-G-T 11743895-G-T *
13869825-A-G 11749119-A-G *
13870485-T-C 11749779-T-C *
13885071-T-C 11764365-T-C Y*
13892395-C-A 11771689-C-A Y*
13932280-T-A 11811574-T-A Y*
13839675-G-T 11718969-G-T *
13960932-A-G 11840226-A-G Y*
13960934-A-G 11840228-A-G Y*
13960935-C-T 11840229-C-T Y*
13964750-C-A 11844044-C-A Y*
13977580-A-G 11856874-A-G Y*
13991616-G-A 11870910-G-A YY*
13991981-G-C 11871275-G-C YY*
13995968-C-G 11875262-C-G Y*
13998493-A-G 11877787-A-G YY*
13842642-G-T 11721936-G-T *
13839446-C-A 11718740-C-A *
14013731-A-G 11893025-A-G Y*
13713178-C-T 11557502-C-T BY54436 *
13706089-G-C 11550413-G-C *
13707472-A-C 11551796-A-C *
13707477-G-T 11551801-G-T *
13708689-G-T 11553013-G-T *
13708692-T-A 11553016-T-A *
13709222-AATGGAATGGAATGGAAGG-A 11553546-AATGGAATGGAATGGAAGG-A *
13711978-CGAATAGAATG-C 11556302-CGAATAGAATG-C *
13712715-A-G 11557039-A-G *
13713203-A-C 11557527-A-C *
13837695-T-C 11716989-T-C *
13724780-A-G 11569104-A-G *
13725591-A-T 11569915-A-T *
13743347-G-A 11587671-G-A *
13798922-G-T 11678216-G-T *
13813726-G-T 11693020-G-T *
13818577-G-T 11697871-G-T FT328490 *
13830614-G-T 11709908-G-T *
13832383-G-T 11711677-G-T *
13837694-C-A 11716988-C-A *
14009281-C-A 11888575-C-A YY*
14046199-G-C 11925493-G-C YY*
14391541-G-T 12270837-G-T Y*
14298085-GT-G 12177379-GT-G *
14249356-T-C 12128650-T-C YY*
14253368-T-C 12132662-T-C YY*
14261168-A-G 12140462-A-G Y*
14263588-G-T 12142882-G-T YY*
14269055-G-A 12148349-G-A Y*
14278443-T-C 12157737-T-C YY*
14286311-A-G 12165605-A-G YY*
14297961-G-C 12177255-G-C YY*
14300658-G-T 12179952-G-T YY*
14233218-C-A 12112512-C-A YY*
14324042-G-A 12203336-G-A YY*
14344961-G-T 12224256-G-T YY*
14345468-G-A 12224763-G-A YY*
14345634-G-A 12224929-G-A YY*
14347560-G-T 12226855-G-T YY*
14347741-A-T 12227036-A-T YY*
14349116-C-A 12228411-C-A YY*
14366011-GA-G 12245306-GA-G *
14374309-C-CT 12253605-C-CT 9×T*
14241099-A-G 12120393-A-G YY*
14229957-G-T 12109251-G-T YY*
14065148-A-G 11944442-A-G YY*
14139373-C-A 12018667-C-A YY*
14076160-G-T 11955454-G-T Y*
14078060-G-T 11957354-G-T YY*
14090771-G-T 11970065-G-T YY*
14091507-C-G 11970801-C-G YY*
14091753-G-T 11971047-G-T YY*
14093146-A-G 11972440-A-G YY*
14098402-T-C 11977696-T-C YY*
14121152-G-A 12000446-G-A Y*
14139067-C-A 12018361-C-A YY*
14151116-G-T 12030410-G-T YY*
14227647-CA-C 12106941-CA-C *
14152422-A-G 12031716-A-G YY*
14176959-C-A 12056253-C-A YY*
14202366-A-G 12081660-A-G YY*
14205887-C-A 12085181-C-A YY*
14211753-G-C 12091047-G-C YY*
14213273-G-T 12092567-G-T YY*
14215771-G-C 12095065-G-C YY*
14219785-C-T 12099079-C-T YY*
14223440-C-A 12102734-C-A YY*
17871189-A-G 15759309-A-G YY*
18091936-G-T 15980056-G-T YY*
17910175-CT-C 15798295-CT-C *
23320588-ATC-A 21158702-ATC-A *
23270781-C-A 21108895-C-A YY*
23279401-G-T 21117515-G-T YY*
23303438-C-A 21141552-C-A YY*
23304101-G-T 21142215-G-T YY*
23313915-G-T 21152029-G-T YY*
23315794-C-T 21153908-C-T YY*
23317973-G-A 21156087-G-A YY*
23318501-G-A 21156615-G-A Y*
23324727-G-C 21162841-G-C YY*
23270320-CA-C 21108434-CA-C *
23326928-C-A 21165042-C-A YY*
23344794-C-T 21182908-C-T YY*
23362416-T-C 21200530-T-C Y*
23363024-G-C 21201138-G-C Y*
23367030-GA-G 21205144-GA-G 8×A*
23369731-A-G 21207845-A-G YY*
23370576-C-A 21208690-C-A YY*
23372935-T-C 21211049-T-C Y*
23393590-A-G 21231704-A-G YY*
23270528-A-G 21108642-A-G YY*
23264367-C-A 21102481-C-A YY*
23403463-T-TTACATCACCAACTTGGACGGCGAAGTATCACAGCATATCGAATATGTACCATTTGGAGAGGTGTTCATAGAAGAACGTAACAACACTTGGAACACGCCTTA 21241577-T-TTACATCACCAACTTGGACGGCGAAGTATCACAGCATATCGAATATGTACCATTTGGAGAGGTGTTCATAGAAGAACGTAACAACACTTGGAACACGCCTTA *
23150526-A-G 20988640-A-G YY*
23111074-C-A 20949188-C-A Y*
23114151-AC-A 20952265-AC-A *
23120147-G-T 20958261-G-T YY*
23123601-C-T 20961715-C-T YY*
23138608-C-A 20976722-C-A YY*
23143218-A-T 20981332-A-T Y*
23146081-T-C 20984195-T-C YY*
23147897-T-C 20986011-T-C YY*
23153725-G-A 20991839-G-A YY*
23263078-C-G 21101192-C-G YY*
23153888-C-A 20992002-C-A YY*
23162897-C-A 21001011-C-A Y*
23170016-G-A 21008130-G-A Y*
23195535-G-T 21033649-G-T Y*
23197052-C-A 21035166-C-A Y*
23208532-T-C 21046646-T-C Y*
23208603-C-A 21046717-C-A Y*
23212264-C-A 21050378-C-A Y*
23234346-G-T 21072460-G-T Y*
23395351-T-TA 21233465-T-TA 9×A*
23404070-TA-T 21242184-TA-T *
23097088-T-C 20935202-T-C YY*
23610494-G-T 21448608-G-T YY*
23586411-G-T 21424525-G-T YY*
23587003-A-G 21425117-A-G YY*
23588806-G-T 21426920-G-T YY*
23595495-T-C 21433609-T-C YY*
23598727-C-A 21436841-C-A YY*
23600517-TC-T 21438631-TC-T *
23601546-G-T 21439660-G-T Y*
23606965-ATGGATTCT-A 21445079-ATGGATTCT-A *
23613713-C-A 21451827-C-A YY*
23562829-C-T 21400943-C-T YY*
23619969-C-A 21458083-C-A YY*
23624606-C-A 21462720-C-A YY*
23634031-G-T 21472145-G-T YY*
23635553-G-T 21473667-G-T YY*
23640913-G-T 21479027-G-T Y*
23650700-C-A 21488814-C-A Y*
23651896-A-G 21490010-A-G Y*
23734040-C-A 21572154-C-A *
23746210-G-T 21584324-G-T Y*
23570853-GCAT-G 21408967-GCAT-G *
23545598-A-AATCCCAGCGAACGAGCCGCTTCCATTTGCCCCTTGTCAACGCTCTCGATACCGCCGCGGATAATCTCGCCAATGTACGCACCGCTATT 21383712-A-AATCCCAGCGAACGAGCCGCTTCCATTTGCCCCTTGTCAACGCTCTCGATACCGCCGCGGATAATCTCGCCAATGTACGCACCGCTATT *
23406227-G-T 21244341-G-T YY*
23479662-TG-T 21317776-TG-T *
23413582-C-T 21251696-C-T YY*
23414539-T-C 21252653-T-C YY*
23430792-C-A 21268906-C-A YY*
23442162-C-G 21280276-C-G Y*
23451003-C-G 21289117-C-G YY*
23460617-A-G 21298731-A-G YY*
23466183-C-T 21304297-C-T FT409132 YY*
23469858-C-A 21307972-C-A YY*
23485763-C-T 21323877-C-T YY*
23536515-C-A 21374629-C-A BY146040 YY*
23493313-T-C 21331427-T-C FTB40935 YY*
23495877-C-A 21333991-C-A YY*
23510193-T-C 21348307-T-C YY*
23515751-C-A 21353865-C-A YY*
23516105-C-A 21354219-C-A YY*
23519795-CA-C 21357909-CA-C 8×A*
23521420-G-A 21359534-G-A Y*
23527763-G-GT 21365877-G-GT *
23533573-G-T 21371687-G-T YY*
23106256-A-G 20944370-A-G Y*
23096395-A-T 20934509-A-T Y*
23764152-CA-C 21602266-CA-C 8×A*
22716279-A-G 20554393-A-G YY*
22617773-T-C 20455887-T-C YY*
22620099-T-C 20458213-T-C Y*
22642427-T-C 20480541-T-C Y*
22646576-G-T 20484690-G-T YY*
22647885-G-T 20485999-G-T YY*
22697427-C-G 20535541-C-G YY*
22699212-A-G 20537326-A-G YY*
22713862-TCACCCCGTCTGGGAGGCGAGGAGCGCCTCTGCCCGGGCGCCCTGTCTGGGAGGTGGGTGCCTCTGCCCGGCCACCCTGTCTGGAAGGTGAGGGGTGACTCTGCTCGGCCGC-T 20551976-TCACCCCGTCTGGGAGGCGAGGAGCGCCTCTGCCCGGGCGCCCTGTCTGGGAGGTGGGTGCCTCTGCCCGGCCACCCTGTCTGGAAGGTGAGGGGTGACTCTGCTCGGCCGC-T *
22722530-T-A 20560644-T-A YY*
22597626-G-T 20435740-G-T YY*
22730332-C-T 20568446-C-T YY*
22744554-ATATC-A 20582668-ATATC-A *
22750868-T-C 20588982-T-C YY*
22759208-G-A 20597322-G-A YY*
22773439-A-G 20611553-A-G YY*
22781421-T-C 20619535-T-C Y*
22781818-C-A 20619932-C-A Y*
22788994-C-A 20627108-C-A Y*
22789176-G-T 20627290-G-T Y*
22606163-G-C 20444277-G-C YY*
22583649-A-G 20421763-A-G FT294153 YY*
22804278-A-G 20642392-A-G YY*
22467020-C-A 20305134-C-A DYZ19 *
22435646-C-A,T 20273760-C-A,T DYZ19 *
22446697-C-A 20284811-C-A DYZ19 *
22458399-TTCAGATATGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAA-T 20296513-TTCAGATATGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAA-T DYZ19 *
22462153-C-G 20300267-C-G BY220835 DYZ19 *
22462166-C-T 20300280-C-T FT457922 DYZ19 *
22462177-T-A 20300291-T-A DYZ19 *
22463134-CTT-C 20301248-CTT-C DYZ19 *
22463137-CAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTTCGGTGAGTGTTACAGCATTTAAAGGTGTTCTGTCCATAGTTTGTTCCT-C 20301251-CAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTTCGGTGAGTGTTACAGCATTTAAAGGTGTTCTGTCCATAGTTTGTTCCT-C DYZ19 *
22470571-G-A 20308685-G-A DYZ19 *
22545995-G-T 20384109-G-T Y*
22476020-C-T 20314134-C-T DYZ19 *
22479383-T-C 20317497-T-C DYZ19 *
22487960-C-T 20326074-C-T DYZ19 *
22489590-G-C 20327704-G-C DYZ19 *
22489891-T-A 20328005-T-A DYZ19 *
22489924-T-A 20328038-T-A DYZ19 *
22509130-G-C 20347244-G-C DYZ19 *
22528319-TA-T 20366433-TA-T *
22544509-G-T 20382623-G-T Y*
22793787-G-T 20631901-G-T YY*
22821284-C-A 20659398-C-A YY*
23094013-C-T 20932127-C-T Y*
23017923-G-A 20856037-G-A Y*
22984605-T-C 20822719-T-C Y*
22984660-G-T 20822774-G-T Y*
22992161-TGTATGAGCTCCTA-T 20830275-TGTATGAGCTCCTA-T *
22997310-G-T 20835424-G-T Y*
23000071-T-C 20838185-T-C YY*
23011358-C-T 20849472-C-T YY*
23013087-C-T 20851201-C-T YY*
23013263-T-C 20851377-T-C YY*
23018661-C-G 20856775-C-G Y*
22977897-C-A 20816011-C-A YY*
23030826-C-T 20868940-C-T YY*
23033243-G-T 20871357-G-T YY*
23050418-G-T 20888532-G-T YY*
23056467-CT-C 20894581-CT-C *
23056597-C-A 20894711-C-A YY*
23060511-C-A 20898625-C-A YY*
23073584-AT-A 20911698-AT-A *
23077428-C-G 20915542-C-G Y*
23077450-G-T 20915564-G-T Y*
22981683-G-T 20819797-G-T Y*
22973238-G-A 20811352-G-A YY*
22821321-G-T 20659435-G-T YY*
22867283-G-T 20705397-G-T YY*
22821608-G-T 20659722-G-T YY*
22822896-G-A 20661010-G-A YY*
22832133-A-G 20670247-A-G YY*
22834920-A-G 20673034-A-G YY*
22845398-C-A 20683512-C-A YY*
22852885-A-G 20690999-A-G Y*
22858006-C-A 20696120-C-A YY*
22867212-T-C 20705326-T-C YY*
22871717-A-G 20709831-A-G Y*
22947083-A-G 20785197-A-G YY*
22875163-C-A 20713277-C-A YY*
22888318-A-T 20726432-A-T YY*
22905418-G-A 20743532-G-A YY*
22907306-C-T 20745420-C-T YY*
22912790-C-A 20750904-C-A YY*
22918921-C-A 20757035-C-A YY*
22925069-G-T 20763183-G-T YY*
22930187-G-T 20768301-G-T YY*
22944040-CA-C 20782154-CA-C 8×A*
23757174-G-T 21595288-G-T Y*
23775084-C-A 21613198-C-A Y*
22353574-C-A 20191688-C-A DYZ19 *
28704996-C-A 26558849-C-A *
28638286-C-A 26492139-C-A *
28645436-G-T 26499289-G-T *
28668684-C-A 26522537-C-A FT421390 *
28674208-C-T 26528061-C-T *
28675940-G-T 26529793-G-T *
28679791-G-A 26533644-G-A *
28691493-G-C 26545346-G-C *
28693116-C-A 26546969-C-A *
28708573-T-C 26562426-T-C *
28597133-G-T 26450986-G-T *
28712943-C-A 26566796-C-A *
28728599-C-A 26582452-C-A *
28739417-G-T 26593270-G-T *
28743446-C-A 26597299-C-A *
28753871-C-T 26607724-C-T *
28765570-TA-T 26619423-TA-T *
28767396-A-G 26621249-A-G Y*
28770917-C-A 26624770-C-A Y*
28777720-G-T 26631573-G-T *
28606662-C-T 26460515-C-T *
28594907-AAG-A 26448760-AAG-A *
28785750-T-C 26639603-T-C *
28555485-C-A 26409338-C-A *
28530669-A-G 26384522-A-G Y*
28531028-G-A 26384881-G-A *
28531034-G-A 26384887-G-A FT59702 *
28531036-G-A 26384889-G-A *
28533315-G-T 26387168-G-T *
28542659-T-C 26396512-T-C *
28545696-CAAA-C,CAAAA 26399549-CAAA-C,CAAAA 26×A*
28546493-G-T 26400346-G-T *
28558780-G-T 26412633-G-T *
28594872-ACCACCGTGC-A 26448725-ACCACCGTGC-A *
28562392-T-C 26416245-T-C *
28567504-G-T 26421357-G-T *
28569290-C-G 26423143-C-G *
28573215-A-G 26427068-A-G *
28573297-C-A 26427150-C-A *
28573636-C-A 26427489-C-A *
28574772-G-T 26428625-G-T *
28585264-C-A 26439117-C-A *
28594690-A-G 26448543-A-G *
28785743-A-C 26639596-A-C *
28785757-G-A 26639610-G-A *
28527778-ATTT-A 26381631-ATTT-A 14×T*
56834244-ATTCCG- *
56829980-TTCCACTCCACTCCAGTCCACTCCACTCCTTTCCATTCCATCCCATTCCATTCCACTCCTTTCCAC- *
56830353-C-CATA *
56830355-C-CTT *
56830357-C-CCATTT *
56832906-C-G *
56832918-C-T *
56832919-C-G *
56833893-G-GTCCACT *
56834535-C-CCGT *
56760261-T-G *
56850842-C-T *
56850848-A-T *
56860155-A-G *
56860195-A-G *
56860209-G-T *
56862750-C-T *
56863409-A-T *
56863429-C-T *
29920-T-G *
56824026-TAAA-T,TAA 11×A*
56747421-C-T *
28785772-G-C 26639625-G-C BY151255 *
28796282-TGCAGCGA-T 26650135-TGCAGCGA-T *
28787311-G-T 26641164-G-T *
28787314-G-GA 26641167-G-GA *
28787315-C-CTGTA 26641168-C-CTGTA *
28787318-G-GTA 26641171-G-GTA *
28787321-G-GAAC 26641174-G-GAAC *
28789484-T-G 26643337-T-G *
28791840-G-T 26645693-G-T *
28795075-A-T 26648928-A-T *
28799511-G-T 26653364-G-T *
56720941-G-C *
28799531-G-C 26653384-G-C *
28802979-GA-G 26656832-GA-G *
28804055-A-G 26657908-A-G *
28814131-G-T 26667984-G-T *
28818403-T-C 26672256-T-C *
56678087-T-C *
56706049-C-T *
56708454-G-C *
56716010-G-T *
28530072-C-A 26383925-C-A Y*
28520758-G-A 26374611-G-A Y*
23775794-C-A 21613908-C-A Y*
24400722-C-A 22254575-C-A Y*
24357620-G-T 22211473-G-T *
24370867-C-A 22224720-C-A *
24371347-A-T 22225200-A-T *
24375571-G-A 22229424-G-A *
24382257-C-A 22236110-C-A Y*
24384834-G-T 22238687-G-T Y*
24392176-T-A 22246029-T-A Y*
24399865-C-A 22253718-C-A Y*
24432203-A-G 22286056-A-G Y*
24148543-C-A 22002396-C-A P3_b1 *
24439809-C-A 22293662-C-A Y*
24464288-G-T 22318141-G-T Y*
24464720-T-A 22318573-T-A Y*
24471269-T-C 22325122-T-C Y*
24478343-C-A 22332196-C-A Y*
24486522-A-AT 22340375-A-AT *
24492578-C-A 22346431-C-A *
24492901-C-A 22346754-C-A *
24494236-G-T 22348089-G-T *
24357301-G-A 22211154-G-A *
24074588-C-T 21928441-C-T P3_b1 *
24506027-A-G 22359880-A-G *
23832832-T-TCCCCC 21670946-T-TCCCCC *
23783214-G-T 21621328-G-T Y*
23789678-C-A 21627792-C-A *
23792045-C-A 21630159-C-A Y*
23797949-C-A 21636063-C-A Y*
23804312-C-G 21642426-C-G Y*
23827280-A-G 21665394-A-G Y*
23828005-C-A 21666119-C-A Y*
23832826-T-TCCCCCC 21670940-T-TCCCCCC *
23832833-T-C 21670947-T-C Y*
23978314-A-G 21832167-A-G Y*
23835513-T-A 21673627-T-A Y*
23846332-C-A 21684446-C-A Y*
23848687-T-C 21686801-T-C Y*
23853184-C-A 21691298-C-A Y*
23856190-G-T 21694304-G-T Y*
23865714-G-T 21703828-G-T Y*
23872752-G-T 21710866-G-T Y*
23954508-C-G 21808361-C-G *
23959065-G-A 21812918-G-A Y*
24500498-G-T 22354351-G-T *
24553331-C-A 22407184-C-A P3_t2 *
28519176-C-A 26373029-C-A Y*
27543526-G-A 25397379-G-A P1_Y2 *
26645954-C-G 24499807-C-G P1_g2 *
26985815-C-A 24839668-C-A P1_r4 *
27168015-C-A 25021868-C-A P1_g3 *
27254084-T-A 25107937-T-A P1_g3 *
27316050-TA-T 25169903-TA-T P1_g3 9×A*
27352561-A-G 25206414-A-G P1_g3 *
27387936-A-G 25241789-A-G P1_g3 *
27389448-G-T 25243301-G-T P1_g3 *
27557589-C-A 25411442-C-A P1_Y2 *
26597689-G-A 24451542-G-A P1_g2 *
27827502-A-G 25681355-A-G P1_Y2 *
27995329-A-G 25849182-A-G P1_Y2 *
28183054-C-T 26036907-C-T P1_b4 *
28225291-T-A 26079144-T-A P1_b4 *
28482146-C-A 26335999-C-A *
28482731-T-TA 26336584-T-TA 8×A*
28489811-G-A 26343664-G-A *
28507301-G-T 26361154-G-T Y*
28517282-A-G 26371135-A-G *
26613175-G-T 24467028-G-T P1_g2 *
26433409-G-T 24287262-G-T P1_Y1 *
24763967-G-T 22617820-G-T P3_b2 *
25303145-T-A 23156998-T-A P2_r1 *
24872603-C-T 22726456-C-T IR1_R *
24880980-C-A 22734833-C-A g1 *
24881802-T-C 22735655-T-C g1 *
24884839-A-G 22738692-A-G g1 *
24885114-C-T 22738967-C-T g1 *
24885990-C-A 22739843-C-A g1 *
24929853-CTA-C 22783706-CTA-C g1 *
25161018-A-G 23014871-A-G g1 *
25303127-T-C 23156980-T-C P2_r1 *
25443349-A-G 23297202-A-G P2_r2 *
26273314-G-A 24127167-G-A P1_Y1 *
25496494-A-T 23350347-A-T P2_r2 *
25566204-G-T 23420057-G-T P1_gr1 *
25630228-G-T 23484081-G-T P1_b3 *
25720424-T-C 23574277-T-C P1_b3 *
25877716-G-T 23731569-G-T P1_Y1 *
25995037-A-C,C 23848890-A-C,C P1_Y1 *
26025101-G-A 23878954-G-A BY226571 P1_Y1 *
26065095-G-T 23918948-G-T P1_Y1 *
26262723-T-C 24116576-T-C P1_Y1 *
22362301-GTTCCTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGATTGTTTCTCCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G 20200415-GTTCCTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGATTGTTTCTCCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G DYZ19 *
22284518-G-T 20122632-G-T DYZ19 *
17915603-G-T 15803723-G-T YY*
19105666-G-T 16993786-G-T YY*
19070669-C-A 16958789-C-A YY*
19074776-T-C 16962896-T-C YY*
19078354-C-A 16966474-C-A YY*
19078688-A-G 16966808-A-G YY*
19081332-G-A 16969452-G-A YY*
19082171-C-A 16970291-C-A Y*
19086891-T-C 16975011-T-C YY*
19094066-C-A 16982186-C-A YY*
19106493-C-A 16994613-C-A YY*
19065830-G-A 16953950-G-A Y*
19109186-G-A 16997306-G-A YY*
19112892-C-A 17001012-C-A YY*
19125249-G-T 17013369-G-T YY*
19141594-C-T 17029714-C-T YY*
19148487-T-C 17036607-T-C YY*
19149532-T-C 17037652-T-C YY*
19153406-C-A 17041526-C-A YY*
19156148-C-A 17044268-C-A YY*
19160906-G-T 17049026-G-T YY*
19067407-CA-C 16955527-CA-C 8×A*
19063454-C-A 16951574-C-A Y*
19177246-T-C 17065366-T-C Y*
18977332-T-C 16865452-T-C YY*
18935915-G-C 16824035-G-C YY*
18938477-T-C 16826597-T-C YY*
18942844-G-T 16830964-G-T YY*
18946963-T-A 16835083-T-A YY*
18963612-C-T 16851732-C-T YY*
18968731-C-A 16856851-C-A Y*
18969777-T-C 16857897-T-C Y*
18974776-G-T 16862896-G-T Y*
19004104-A-G 16892224-A-G YY*
19032217-T-C 16920337-T-C YY*
19009629-GA-G 16897749-GA-G *
19014342-C-G 16902462-C-G Y*
19015240-G-T 16903360-G-T Y*
19017650-G-T 16905770-G-T Y*
19019864-G-A 16907984-G-A Y*
19021714-C-T 16909834-C-T YY*
19022227-C-A 16910347-C-A YY*
19027127-C-G 16915247-C-G Y*
19031155-G-T 16919275-G-T Y*
19170563-C-G 17058683-C-G Y*
19196408-T-C 17084528-T-C YY*
18932375-C-A 16820495-C-A Y*
19508829-T-C 17396949-T-C YY*
19426362-T-C 17314482-T-C Y*
19428656-T-C 17316776-T-C Y*
19434374-G-A 17322494-G-A Y*
19441344-T-C 17329464-T-C YY*
19452856-C-T 17340976-C-T YY*
19457942-G-C 17346062-G-C YY*
19489837-G-T 17377957-G-T Y*
19507343-G-T 17395463-G-T YY*
19529226-G-T 17417346-G-T YY*
19422378-G-T 17310498-G-T YY*
19529236-C-A 17417356-C-A YY*
19533303-G-T 17421423-G-T YY*
19537670-G-A 17425790-G-A FTB40639 YY*
19541612-A-G 17429732-A-G Y*
19549812-T-C 17437932-T-C YY*
19560497-G-T 17448617-G-T Y*
19562606-C-T 17450726-C-T Y*
19562615-C-G 17450735-C-G Y*
19756505-G-T 17644625-G-T P5_Prx *
19423027-C-A 17311147-C-A YY*
19374096-C-T 17262216-C-T YY*
19208216-T-C 17096336-T-C YY*
19278775-TGGATCTAGCATATG-T 17166895-TGGATCTAGCATATG-T *
19208242-G-T 17096362-G-T YY*
19215755-C-A 17103875-C-A YY*
19220685-G-T 17108805-G-T YY*
19222878-C-A 17110998-C-A YY*
19226975-C-T 17115095-C-T YY*
19236757-C-A 17124877-C-A YY*
19244427-T-C 17132547-T-C YY*
19259234-T-C 17147354-T-C YY*
19291816-T-C 17179936-T-C YY*
19367724-C-T 17255844-C-T BY208057 YY*
19301048-CAT-C 17189168-CAT-C *
19307122-AC-A 17195242-AC-A *
19314125-C-G 17202245-C-G YY*
19327667-G-T 17215787-G-T Y*
19339986-C-CTTTT 17228106-C-CTTTT 31×T*
19345191-C-A 17233311-C-A YY*
19346162-T-C 17234282-T-C YY*
19356432-G-A 17244552-G-A YY*
19361575-A-G 17249695-A-G YY*
18932895-C-T 16821015-C-T YY*
18921624-AG-A 16809744-AG-A *
20803809-C-T 18641923-C-T FT283595 P4_Gap *
18181778-C-A 16069898-C-A YY*
18146934-T-C 16035054-T-C YY*
18150506-C-A 16038626-C-A YY*
18152049-G-T 16040169-G-T Y*
18152682-C-A 16040802-C-A Y*
18156457-G-T 16044577-G-T Y*
18163145-C-A 16051265-C-A YY*
18168062-G-T 16056182-G-T YY*
18169268-T-C 16057388-T-C YY*
18191442-C-T 16079562-C-T FT139795 Y*
18130366-G-A 16018486-G-A YY*
18203144-G-A 16091264-G-A YY*
18220733-C-T 16108853-C-T Y*
18221584-T-C 16109704-T-C Y*
18233831-T-A 16121951-T-A Y*
18242939-C-T 16131059-C-T Y*
18245051-AC-A 16133171-AC-A *
18247739-A-G 16135859-A-G Y*
18249870-C-T 16137990-C-T Y*
18255212-C-A 16143332-C-A Y*
18146347-G-T 16034467-G-T YY*
18126083-G-T 16014203-G-T YY*
18258988-G-T 16147108-G-T *
18042460-G-C 15930580-G-C Y*
17917768-T-C 15805888-T-C YY*
17936687-G-C 15824807-G-C YY*
17941693-T-C 15829813-T-C YY*
17950454-G-A 15838574-G-A YY*
17999449-C-T 15887569-C-T P7_Gap Y*
18021540-A-T 15909660-A-T Y*
18031054-G-T 15919174-G-T YY*
18035096-C-T 15923216-C-T YY*
18053938-C-G 15942058-C-G Y*
18125658-C-A 16013778-C-A YY*
18056211-T-C 15944331-T-C Y*
18057298-T-C 15945418-T-C Y*
18067923-C-A 15956043-C-A YY*
18072506-T-C 15960626-T-C FT240175 YY*
9644267-C-A 9806658-C-A IR3_Prx *
18105538-G-T 15993658-G-T YY*
18105856-G-A 15993976-G-A YY*
18118516-T-C 16006636-T-C YY*
18120315-T-C 16008435-T-C Y*
18257732-G-A 16145852-G-A *
18260132-G-A 16148252-G-A *
18912172-A-G 16800292-A-G YY*
18803126-T-C 16691246-T-C YY*
18719066-A-G 16607186-A-G YY*
18733347-G-C 16621467-G-C YY*
18737746-C-A 16625866-C-A YY*
18741687-A-G 16629807-A-G YY*
18756032-C-A 16644152-C-A YY*
18759355-G-C 16647475-G-C YY*
18762914-G-T 16651034-G-T YY*
18771656-C-A 16659776-C-A YY*
18815326-G-T 16703446-G-T YY*
18690189-C-A 16578309-C-A YY*
18833626-C-A 16721746-C-A YY*
18840463-C-A 16728583-C-A YY*
18867902-G-T 16756022-G-T YY*
18873722-T-C 16761842-T-C Y*
18875018-TC-T 16763138-TC-T *
18875229-C-A 16763349-C-A Y*
18878551-C-A 16766671-C-A Y*
18897970-A-G 16786090-A-G YY*
18902958-A-G 16791078-A-G YY*
18715811-G-A 16603931-G-A YY*
18669946-G-T 16558066-G-T YY*
18386965-C-A 16275085-C-A P6_Gap *
18544029-A-G 16432149-A-G Y*
18403238-AG-A 16291358-AG-A P6_Gap *
18404797-C-G 16292917-C-G P6_Gap *
18409077-G-T 16297197-G-T P6_Gap *
18409098-G-T 16297218-G-T P6_Gap *
18411753-G-T 16299873-G-T P6_Gap *
18413963-TAA-T 16302083-TAA-T P6_Gap 9×A*
18424453-C-T 16312573-C-T FT50952 P6_Gap *
18524517-A-G 16412637-A-G P6_Dst *
18542740-A-G 16430860-A-G Y*
18558666-A-T 16446786-A-T YY*
18665828-T-C 16553948-T-C YY*
18560731-C-T 16448851-C-T YY*
18572342-C-A 16460462-C-A YY*
18574841-G-T 16462961-G-T YY*
18575521-AT-A 16463641-AT-A *
18593166-T-C 16481286-T-C YY*
18597268-A-G 16485388-A-G YY*
18606691-T-C 16494811-T-C YY*
18607967-G-T 16496087-G-T YY*
18657462-C-T 16545582-C-T YY*
20005955-C-A 17894075-C-A P5_Prx *
20812529-G-T 18650643-G-T P4_Gap *
22267828-C-G 20105942-C-G DYZ19 *
21746596-C-A 19584710-C-A Y*
21702510-C-T 19540624-C-T YY*
21702679-C-A 19540793-C-A YY*
21707966-A-AT 19546080-A-AT *
21708822-G-C 19546936-G-C Y*
21713906-T-C 19552020-T-C YY*
21715405-A-G 19553519-A-G YY*
21723871-C-T 19561985-C-T YY*
21743825-G-C 19581939-G-C Y*
21764522-GT-G 19602636-GT-G *
21694746-C-T 19532860-C-T YY*
21770378-C-A 19608492-C-A Y*
21771440-A-G 19609554-A-G YY*
21799565-T-C 19637679-T-C YY*
21809981-G-T 19648095-G-T YY*
21812158-C-A 19650272-C-A YY*
21821267-G-T 19659381-G-T Y*
21829356-T-C 19667470-T-C Y*
21842682-G-T 19680796-G-T Y*
21844608-G-T 19682722-G-T YY*
21694760-G-T 19532874-G-T YY*
21690067-C-A 19528181-C-A YY*
21861092-A-C 19699206-A-C YY*
21633782-A-G 19471896-A-G Y*
21588329-C-A 19426443-C-A Y*
21588990-T-C 19427104-T-C Y*
21591438-A-T 19429552-A-T YY*
21602597-G-A 19440711-G-A YY*
21615749-G-T 19453863-G-T YY*
21629167-T-C 19467281-T-C YY*
21630386-G-T 19468500-G-T Y*
21632902-G-T 19471016-G-T Y*
21637349-C-A 19475463-C-A YY*
21682453-G-A 19520567-G-A YY*
21639779-T-C 19477893-T-C YY*
21642640-G-T 19480754-G-T YY*
21648099-C-A 19486213-C-A YY*
21650504-G-C 19488618-G-C YY*
21654796-C-A 19492910-C-A YY*
21662718-C-A 19500832-C-A YY*
21667397-C-G 19505511-C-G YY*
21675527-GA-G 19513641-GA-G 8×A*
21678294-G-T 19516408-G-T Y*
21851913-C-T 19690027-C-T Y*
21862199-G-T 19700313-G-T YY*
21577513-G-T 19415627-G-T Y*
22158739-A-G 19996853-A-G YY*
22058321-CAAA-C 19896435-CAAA-C 11×A*
22077495-G-T 19915609-G-T YY*
22093500-G-T 19931614-G-T YY*
22093776-C-T 19931890-C-T YY*
22096665-A-T 19934779-A-T YY*
22110885-C-A 19948999-C-A YY*
22152378-G-T 19990492-G-T Y*
22158003-G-T 19996117-G-T YY*
22166211-T-C 20004325-T-C BY138123 YY*
22051173-G-T 19889287-G-T Y*
22178225-C-A 20016339-C-A FT378450 YY*
22196781-T-C 20034895-T-C Y*
22203312-T-C 20041426-T-C YY*
22212745-C-A 20050859-C-A Y*
22238337-AAGGTCTGCAGCTTCATTCTTGAAGTGAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCT-A 20076451-AAGGTCTGCAGCTTCATTCTTGAAGTGAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCT-A DYZ19 *
22240624-A-G 20078738-A-G DYZ19 *
22240761-C-A 20078875-C-A DYZ19 *
22245504-C-A 20083618-C-A DYZ19 *
22255910-C-T 20094024-C-T DYZ19 *
22051952-C-A 19890066-C-A Y*
22041747-TA-T 19879861-TA-T *
21872847-G-T 19710961-G-T YY*
21952673-G-A 19790787-G-A YY*
21879454-G-T 19717568-G-T YY*
21894843-A-G 19732957-A-G YY*
21913183-G-T 19751297-G-T Y*
21919935-CTCTAGG-C 19758049-CTCTAGG-C *
21922994-C-A 19761108-C-A YY*
21928673-TA-T 19766787-TA-T *
21931477-G-A 19769591-G-A YY*
21941130-C-T 19779244-C-T Y*
21954926-C-A 19793040-C-A Y*
22036103-A-G 19874217-A-G YY*
21959558-A-G 19797672-A-G YY*
21959814-G-T 19797928-G-T YY*
21967252-C-A 19805366-C-A Y*
21985273-A-G 19823387-A-G YY*
21992857-T-C 19830971-T-C YY*
22002418-G-A 19840532-G-A YY*
22008405-C-T 19846519-C-T YY*
22011171-G-T 19849285-G-T YY*
22029341-TA-T 19867455-TA-T *
21585760-C-T 19423874-C-T Y*
21575513-G-A 19413627-G-A Y*
20824393-G-T 18662507-G-T P4_Gap *
21250187-G-A 19088301-G-A FT188700 YY*
21165869-C-A 19003983-C-A YY*
21185108-A-G 19023222-A-G YY*
21200168-A-G 19038282-A-G YY*
21215464-G-T 19053578-G-T YY*
21216626-C-G 19054740-C-G YY*
21221977-TAA-T 19060091-TAA-T 10×A*
21226286-A-T 19064400-A-T YY*
21243714-A-G 19081828-A-G Y*
21250357-T-C 19088471-T-C YY*
21156633-A-G 18994747-A-G Y*
21265825-C-T 19103939-C-T YY*
21265863-T-C 19103977-T-C YY*
21268817-A-G 19106931-A-G FT243908 Y*
21269887-C-T 19108001-C-T Y*
21278075-C-A 19116189-C-A Y*
21280583-T-C 19118697-T-C Y*
21283152-G-T 19121266-G-T YY*
21285887-C-A 19124001-C-A YY*
21292213-C-A 19130327-C-A YY*
21156640-A-G 18994754-A-G Y*
21143019-G-A 18981133-G-A YY*
21299142-G-T 19137256-G-T YY*
21057239-C-A 18895353-C-A Y*
20829171-G-T 18667285-G-T P4_Gap *
20830488-G-T 18668602-G-T P4_Gap *
20832264-G-T 18670378-G-T P4_Gap *
20841301-C-A 18679415-C-A P4_Gap *
20987215-TG-T 18825329-TG-T P4_Dst *
21031527-T-G 18869641-T-G P4_Dst Y*
21035008-A-G 18873122-A-G Y*
21046290-T-C 18884404-T-C Y*
21058936-C-A 18897050-C-A Y*
21142181-TC-T 18980295-TC-T *
21070811-G-T 18908925-G-T YY*
21072211-T-C 18910325-T-C FTA48982 YY*
21072248-CT-C 18910362-CT-C *
21089430-G-A 18927544-G-A YY*
21104214-T-A 18942328-T-A YY*
21105565-A-G 18943679-A-G YY*
21107842-G-T 18945956-G-T Y*
21121774-A-G 18959888-A-G Y*
21125698-G-A 18963812-G-A YY*
21298714-G-T 19136828-G-T YY*
21301351-TC-T 19139465-TC-T *
21549260-G-T 19387374-G-T YY*
21492437-TA-T 19330551-TA-T *
21463959-T-C 19302073-T-C YY*
21465097-C-A 19303211-C-A YY*
21466896-A-G 19305010-A-G YY*
21467306-C-A 19305420-C-A YY*
21467446-A-G 19305560-A-G YY*
21480769-C-A 19318883-C-A YY*
21488055-G-T 19326169-G-T YY*
21489389-C-G 19327503-C-G YY*
21497497-C-T 19335611-C-T Y*
21448706-G-A 19286820-G-A Y*
21498610-C-A 19336724-C-A Y*
21506939-T-C 19345053-T-C YY*
21510906-C-A 19349020-C-A YY*
21528139-C-A 19366253-C-A YY*
21530810-T-C 19368924-T-C YY*
21534242-C-A 19372356-C-A YY*
21536436-C-A 19374550-C-A Y*
21547100-C-A 19385214-C-A YY*
21548675-A-T 19386789-A-T YY*
21453278-G-T 19291392-G-T YY*
21447113-G-A 19285227-G-A YY*
21308970-G-T 19147084-G-T YY*
21360159-T-C 19198273-T-C YY*
21311418-A-T 19149532-A-T YY*
21317311-G-A 19155425-G-A YY*
21324843-C-A 19162957-C-A Y*
21327526-C-T 19165640-C-T YY*
21330053-G-T 19168167-G-T YY*
21330657-T-C 19168771-T-C YY*
21337697-G-T 19175811-G-T Y*
21355070-T-C 19193184-T-C YY*
21360045-C-A 19198159-C-A YY*
21366469-TTCCTCATC-T 19204583-TTCCTCATC-T *
21446503-G-T 19284617-G-T YY*
21370437-G-T 19208551-G-T YY*
21374085-G-T 19212199-G-T YY*
21377779-T-C 19215893-T-C Y*
21379002-G-T 19217116-G-T Y*
21391976-C-A 19230090-C-A YY*
21417248-G-T 19255362-G-T Y*
21429731-A-C 19267845-A-C YY*
21429768-T-C 19267882-T-C YY*
21430110-C-T 19268224-C-T YY*
9672485-T-C 9834876-T-C IR3_Prx *
9427057-C-G 9589448-C-G YY*
9591651-G-T 9754042-G-T IR3_Prx *
15671397-T-C 13559517-T-C Y*
4635955-G-A 4767914-G-A *
4636042-C-G 4768001-C-G *
4797787-A-C 4929746-A-C *
5193796-T-C 5325755-T-C *
9942789-T-A 10105180-T-A Y*
9951180-C-G 10113571-C-G Y*
13576760-T-C 11421084-T-C *
13576763-G-A 11421087-G-A *
22790473-C-T 20628587-C-T Y*
3167067-G-C 3299026-G-C *
28813130-T-A 26666983-T-A *
13699106-AGAATG-A 11543430-AGAATG-A 4×GAATG*
3084920-A-G 3216879-A-G *
9944658-G-T 10107049-G-T Y*
9944687-T-C 10107078-T-C Y*
9944710-G-T 10107101-G-T Y*
13478508-ATT-A 11322832-ATT-A *
13692444-G-A 11536768-G-A *
13697167-T-C 11541491-T-C *
4635938-C-T 4767897-C-T *
13576712-G-A 11421036-G-A FT445676 *
28814600-G-A 26668453-G-A *
28517668-G-GA 26371521-G-GA 9×A*
6022074-A-G 6154033-A-G *
22508580-T-G 20346694-T-G DYZ19 *
5794784-T-TA 5926743-T-TA 9×A*
16948363-C-CTT 14836483-C-CTT 14×T*
23306553-T-C 21144667-T-C YY*
12903343-CTTTTTTT-C,CTTTTTT 25×T*
2957788-C-CT 3089747-C-CT 9×T*
28797153-A-T 26651006-A-T *
2857740-T-C 2989699-T-C Y*
13576709-T-C 11421033-T-C *
13488594-C-A 11332918-C-A *
14862874-C-T 12750940-C-T YY*
3340300-CA-C 3472259-CA-C 8×A*
4744338-TA-T 4876297-TA-T 8×A*
9944655-C-G 10107046-C-G Y*
10004791-A-G 10167182-A-G Y*
13470639-G-C 11314963-G-C *
13488592-C-T 11332916-C-T *
13576708-A-G 11421032-A-G *
13711747-TGGAACGGAATGGAATTAAATGGAAC-T 11556071-TGGAACGGAATGGAATTAAATGGAAC-T *
56734340-G-A *
3535073-A-G 3667032-A-G *
13465908-G-A 11310232-G-A *
13476189-TAA-T 11320513-TAA-T *
13476194-A-ACG 11320518-A-ACG *
28805948-A-T 26659801-A-T *
7717872-T-C 7849831-T-C YY*
6058816-C-T 6190775-C-T *
19562593-G-A 17450713-G-A Y*
9954445-T-C 10116836-T-C Y*
9974352-A-ATTTTT,T 10136743-A-ATTTTT,T *
3587532-T-G 3719491-T-G *
13725859-G-A 11570183-G-A *
13474325-A-G 11318649-A-G *
4800088-A-G 4932047-A-G *
3571870-T-C 3703829-T-C *
13692498-T-A 11536822-T-A *
13692505-T-C 11536829-T-C *
13692540-T-A 11536864-T-A FT448732 *
56749814-T-G *
13463805-A-T 11308129-A-T *
13473409-A-T 11317733-A-T *
56678030-G-A,A *
13718565-G-A 11562889-G-A FT265111 *
56764007-G-A *
13428971-C-T 11273295-C-T *
9944686-G-A 10107077-G-A Y*
9944688-G-A 10107079-G-A Y*
13194078-C-T 11038402-C-T *
22256109-A-G 20094223-A-G DYZ19 *
28805952-G-C 26659805-G-C *
9964208-GGAAAAAA-G 10126599-GGAAAAAA-G *
13428931-G-A 11273255-G-A *
13428942-C-G 11273266-C-G *
13721143-A-T 11565467-A-T *
13446534-CCATTCCAT-C 11290858-CCATTCCAT-C *
18839339-G-C 16727459-G-C YY*
28812489-CAT-C 26666342-CAT-C *
28812492-G-GAA 26666345-G-GAA *
28819098-G-GA 26672951-G-GA *
13194067-C-G 11038391-C-G *
13478723-C-T 11323047-C-T *
22489784-T-C 20327898-T-C DYZ19 *
23403462-T-TAA 21241576-T-TAA *
28796605-T-C 26650458-T-C *
8405334-GA-G 8537293-GA-G 10×A*
28620558-C-CAA 26474411-C-CAA 16×A*
6401113-G-A 6533072-G-A FT28710 *
7922412-C-A 8054371-C-A YY*
13462622-C-A 11306946-C-A *
13454857-C-G 11299181-C-G *
13463343-C-G 11307667-C-G *
15429511-C-A 13317631-C-A YY*
21965774-CAAA-C 19803888-CAAA-C 19×A*
3194380-AT-A 3326339-AT-A 9×T*
10654730-C-A *
18930017-C-A 16818137-C-A YY*
3967284-G-A 4099243-G-A *
13463365-G-C 11307689-G-C *
3967287-A-G 4099246-A-G *
13464965-C-A 11309289-C-A *
13464976-A-C 11309300-A-C *
13465032-G-A 11309356-G-A *
21189668-CAA-C,CA 19027782-CAA-C,CA 23×A*
7918132-T-C 8050091-T-C Y*
13868716-G-C 11748010-G-C *
15422964-T-TC 13311084-T-TC *
10004716-C-T 10167107-C-T Y*
13463370-C-G 11307694-C-G *
22529886-G-C 20368000-G-C Y*
10004773-T-A 10167164-T-A Y*
14765051-G-T 12653120-G-T YY*
15057738-ATTTT-A 12945830-ATTTT-A 18×T*
24429895-G-T 22283748-G-T Y*
9013206-C-G 9175597-C-G Y*
18936208-CT-C 16824328-CT-C 8×T*
13213950-G-T 11058274-G-T *
26716273-A-G 24570126-A-G P1_g2 *
21115831-C-A 18953945-C-A YY*
9925178-A-T 10087569-A-T Y*
25045977-C-CT 22899830-C-CT g1 9×T*
6700781-C-T 6832740-C-T YY*
8585651-C-A 8717610-C-A YY*
5531028-GAA-G 5662987-GAA-G 12×A*
23633371-CTTT-C,CTT 21471485-CTTT-C,CTT 21×T*
8134659-TA-T 8266618-TA-T *
26358870-G-A 24212723-G-A P1_Y1 *
3992054-C-A 4124013-C-A *
5412346-C-A 5544305-C-A *
14012478-C-A 11891772-C-A Y*
13488593-C-A 11332917-C-A *
10004757-G-A 10167148-G-A Y*
10004778-TAA-T 10167169-TAA-T *
16494360-T-C 14382480-T-C YY*
13442785-G-T 11287109-G-T *
6451957-G-GTT 6583916-G-GTT 17×T*
13709589-G-A 11553913-G-A *
13462623-C-A 11306947-C-A BY85627 *
18132772-AT-A 16020892-AT-A 9×T*
13905796-A-AT 11785090-A-AT 9×T*
9925159-C-G 10087550-C-G Y*
13960941-T-C 11840235-T-C Y*
6089764-GTT-G,GT 6221723-GTT-G,GT 31×T*
5130526-C-A 5262485-C-A *
22257386-C-A 20095500-C-A DYZ19 *
9942758-G-C 10105149-G-C Y*
13465037-T-A 11309361-T-A *
22674121-CAAA-C 20512235-CAAA-C 14×A*
21797624-A-AT 19635738-A-AT 9×T*
9941838-C-T 10104229-C-T Y*
9013215-G-T 9175606-G-T Y*
13576750-G-A 11421074-G-A *
28780099-A-AT 26633952-A-AT 8×T*
6051219-G-A 6183178-G-A *
13734378-A-T 11578702-A-T *
19319834-GTATATATATA-G 17207954-GTATATATATA-G 23×TA*
13462349-C-T 11306673-C-T *
13709639-G-T 11553963-G-T *
18976448-C-T 16864568-C-T YY*
9968000-G-A 10130391-G-A Y*
9967984-TGC-T 10130375-TGC-T *
9967987-TC-T 10130378-TC-T *
13446531-ATT-A 11290855-ATT-A *
16583245-C-T 14471365-C-T YY*
6528970-A-T 6660929-A-T *
4088480-C-A 4220439-C-A *
13488561-G-C 11332885-G-C *
5350037-CTTTT-C 5481996-CTTTT-C 21×T*
56722383-C-T *
4917601-C-CTT 5049560-C-CTT 16×T*
8589744-G-T 8721703-G-T YY*
6401115-T-C 6533074-T-C *
9967977-G-A 10130368-G-A Y*
9967979-C-A 10130370-C-A Y*
13454854-T-C 11299178-T-C *
13700381-G-C 11544705-G-C *
28799524-C-G 26653377-C-G *
13709244-T-C 11553568-T-C *
13487749-C-CAA 11332073-C-CAA *
6401119-G-T 6533078-G-T *
22509081-G-GT 20347195-G-GT DYZ19 *
3151554-G-T 3283513-G-T *
3102426-T-TC 3234385-T-TC *
3109529-G-T 3241488-G-T *
3112933-GA-G 3244892-GA-G *
3113116-TAAAATAGCTGA-T 3245075-TAAAATAGCTGA-T *
3141632-T-C 3273591-T-C *
3142920-G-T 3274879-G-T *
3147038-C-T 3278997-C-T *
3149105-C-A 3281064-C-A *
3163583-T-A 3295542-T-A *
3088465-C-A 3220424-C-A *
3165841-C-T 3297800-C-T *
3169863-A-G 3301822-A-G *
3175374-T-C 3307333-T-C *
3180730-T-C 3312689-T-C *
3193247-G-T 3325206-G-T *
3198279-A-G 3330238-A-G *
3203918-A-G 3335877-A-G *
3206396-C-A 3338355-C-A *
3212612-G-T 3344571-G-T *
3096150-C-T 3228109-C-T *
3086787-T-A 3218746-T-A *
3223972-C-G 3355931-C-G *
3017678-G-T 3149637-G-T *
2949245-C-T 3081204-C-T *
2960810-G-T 3092769-G-T *
2968665-C-A 3100624-C-A *
2969542-A-G 3101501-A-G *
2975506-A-G 3107465-A-G *
2982867-T-C 3114826-T-C *
3005771-G-A 3137730-G-A *
3009616-T-C 3141575-T-C *
3026261-T-C 3158220-T-C *
3084331-C-A 3216290-C-A *
3027991-T-C 3159950-T-C *
3034438-C-T 3166397-C-T *
3042016-T-C 3173975-T-C *
3045777-ATAAAGCC-A 3177736-ATAAAGCC-A *
3049312-T-C 3181271-T-C *
3050468-A-G 3182427-A-G *
3062621-G-T 3194580-G-T *
3064252-AAATATTTAAAG-A 3196211-AAATATTTAAAG-A *
3076686-T-C 3208645-T-C *
3220421-G-T 3352380-G-T *
3223974-C-A 3355933-C-A *
2916644-G-T 3048603-G-T Y*
3455515-C-A 3587474-C-A *
3400369-C-A 3532328-C-A *
3401914-TACAGCAAAAG-T 3533873-TACAGCAAAAG-T *
3409491-C-A 3541450-C-A *
3411728-G-T 3543687-G-T *
3421509-T-A 3553468-T-A *
3445501-C-A 3577460-C-A *
3448710-T-C 3580669-T-C *
3453795-G-A 3585754-G-A *
3457783-A-G 3589742-A-G *
3378224-G-T 3510183-G-T *
3466810-A-AT 3598769-A-AT 9×T*
3472556-T-C 3604515-T-C *
3473052-G-T 3605011-G-T *
3477903-G-T 3609862-G-T *
3484725-C-A 3616684-C-A *
3494193-G-T 3626152-G-T *
3499938-A-G 3631897-A-G *
3510355-T-A 3642314-T-A *
3520458-G-A 3652417-G-A *
3386618-C-A 3518577-C-A *
3373839-G-C 3505798-G-C *
3234839-T-C 3366798-T-C *
3311008-C-A 3442967-C-A FT3582 *
3242444-G-T 3374403-G-T *
3243248-G-T 3375207-G-T *
3248513-T-C 3380472-T-C *
3250922-G-T 3382881-G-T *
3265847-C-A 3397806-C-A *
3286570-T-C 3418529-T-C *
3286692-G-C 3418651-G-C *
3289198-G-C 3421157-G-C *
3294871-A-G 3426830-A-G *
3315448-G-T 3447407-G-T *
3354453-C-A 3486412-C-A *
3316595-G-C 3448554-G-C *
3322931-C-T 3454890-C-T *
3323944-G-T 3455903-G-T *
3334884-A-G 3466843-A-G *
3340480-T-C 3472439-T-C *
3342352-G-T 3474311-G-T *
3343608-CTGTATAGT-C 3475567-CTGTATAGT-C *
3345140-G-T 3477099-G-T *
3347278-G-A 3479237-G-A *
2937553-A-G 3069512-A-G FT82364 *
2915326-A-G 3047285-A-G Y*
13468588-C-G 11312912-C-G *
13697038-T-A 11541362-T-A *
13466901-A-T 11311225-A-T *
13466903-A-G 11311227-A-G *
13466913-C-T 11311237-C-T *
13466918-G-T 11311242-G-T *
10041910-G-A 10204301-G-A *
13470562-G-A 11314886-G-A *
56834777-T-TTACATTCCACTCCAC *
11333039-C- *
28814779-A-G 26668632-A-G *
56764001-G-A *
28814814-G-A 26668667-G-A *
13693509-G-A 11537833-G-A *
11562640-GAATGGAATGGAATGA- *
13462598-C-G 11306922-C-G *
28796201-ATGGAATGGAGTGGATT-A 26650054-ATGGAATGGAGTGGATT-A *
28796270-A-T 26650123-A-T *
28796291-G-T 26650144-G-T BY151542 *
28796297-T-TAGATA 26650150-T-TAGATA *
13410527-C-T 11254851-C-T *
11556073-GAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA- *
28802870-A-T 26656723-A-T *
25995035-A-C,C 23848888-A-C,C P1_Y1 *
8176331-C-G 8308290-C-G Y*
13478507-C-CGG 11322831-C-CGG *
22255903-T-G 20094017-T-G DYZ19 *
22255904-A-T 20094018-A-T DYZ19 *
22529887-G-C 20368001-G-C Y*
28785983-A-AAGGAG 26639836-A-AAGGAG *
13485996-C-G 11330320-C-G *
15897473-ATTTTC-A 13785593-ATTTTC-A *
3278326-C-T 3410285-C-T *
13488955-C-G 11333279-C-G *
18839341-T-C 16727461-T-C YY*
13709404-T-A 11553728-T-A *
28802865-ACT-A 26656718-ACT-A *
13465986-C-CAA 11310310-C-CAA *
13465990-GC-G 11310314-GC-G *
13465995-T-G 11310319-T-G *
27432762-TA-T 25286615-TA-T P1_g3 12×A*
56678169-G-T *
13420221-A-T 11264545-A-T *
13576704-C-T 11421028-C-T *
11295320-C- *
13488607-G-T 11332931-G-T *
2914748-G-T 3046707-G-T Y*
2835687-C-T 2967646-C-T YY*
2763151-T-C 2895110-T-C YY*
2765272-A-T 2897231-A-T YY*
2785641-G-T 2917600-G-T YY*
2786298-A-T 2918257-A-T Y*
2812490-G-C 2944449-G-C YY*
2812619-T-G 2944578-T-G YY*
2819591-G-T 2951550-G-T YY*
2827938-G-A 2959897-G-A YY*
2837509-C-T 2969468-C-T YY*
2744147-G-C 2876106-G-C YY*
2840471-GT-G 2972430-GT-G 8×T*
2850251-C-T 2982210-C-T YY*
2858291-G-T 2990250-G-T Y*
2863479-G-T 2995438-G-T YY*
2864071-G-C 2996030-G-C YY*
2866780-G-T 2998739-G-T YY*
2880095-T-C 3012054-T-C YY*
2893863-G-C 3025822-G-C YY*
2913807-C-A 3045766-C-A Y*
2751792-C-A 2883751-C-A YY*
2742267-TTTTATA-T 2874226-TTTTATA-T *
13463338-G-T 11307662-G-T *
56834615-C-CTCCACTCCACTCCTCTCCACTCCATTCCATTCCAT *
21128199-C-T 18966313-C-T YY*
13689201-A-AAATAG 11533525-A-AAATAG *
13707146-TA-T 11551470-TA-T *
56878253-G-GCA,GCACACACACACA 9×CA*
13693609-G-A 11537933-G-A *
13693611-A-C 11537935-A-C *
13721405-T-A 11565729-T-A *
56734287-A-T *
8043794-A-G 8175753-A-G Y*
13573811-T-A 11418135-T-A *
2731234-C-A 2863193-C-A YY*
2654240-C-A 2786199-C-A Y*
2657425-A-G 2789384-A-G YY*
2661031-T-C 2792990-T-C YY*
2683169-G-A 2815128-G-A Y8×T*
2690031-T-C 2821990-T-C YY*
2704224-CTG-C 2836183-CTG-C *
2704331-G-T 2836290-G-T YY*
2711638-G-T 2843597-G-T YY*
2713150-C-T 2845109-C-T YY*
17943268-C-A 15831388-C-A YY*
14358242-C-A 12237537-C-A YY*
3525393-C-A 3657352-C-A *
58988647-T-G 56842500-T-G *
58988648-T-C 56842501-T-C *
58912757-C-T 56678114-G-A *
58912771-T-C 56678100-A-G *
58846435-C-T 56744436-G-A *
13485656-G-T 11329980-G-T *
23519129-A-C 21357243-A-C Y*
23519130-G-A 21357244-G-A Y*
28819096-T-A 26672949-T-A *
13469086-G-C 11313410-G-C *
13665093-C-T 11509417-C-T BY87583 *
6725184-T-C 6857143-T-C Y*
13489605-C-T 11333929-C-T *
13489610-T-A 11333934-T-A *
13489611-G-T 11333935-G-T *
58842970-G-C 56747901-C-G *
58840810-C-T 56750061-G-A *
13461107-C-G 11305431-C-G *
58840851-T-C 56750020-A-G *
13489152-G-A 11333476-G-A *
22255906-T-C 20094020-T-C DYZ19 *
13465401-T-G 11309725-T-G *
13489624-C-A 11333948-C-A *
59020879-C-A 56874732-C-A *
28605368-GAAT-G 26459221-GAAT-G *
28793260-G-C 26647113-G-C *
28793857-T-A 26647710-T-A *
28813005-T-A 26666858-T-A *
58866388-C-T 56724483-G-A *
59006379-C-A 56860232-C-A *
59009771-G-A 56863624-G-A *
59013026-A-T 56866879-A-T *
59021463-A-G 56875316-A-G *
13465366-T-C 11309690-T-C *
59023473-T-G 56877326-T-G *
59025007-A-G 56878860-A-G *
13489500-A-C 11333824-A-C *
58837731-A-G 56753140-T-C *
13470543-C-T 11314867-C-T *
13470546-G-A 11314870-G-A *
13470552-C-A 11314876-C-A *
58884552-C-T 56706319-G-A *
13396537-C-T 11240861-C-T *
13489488-G-A 11333812-G-A *
22701592-G-GT 20539706-G-GT 9×T*
22255893-T-C 20094007-T-C DYZ19 *
5088916-T-C 5220875-T-C *
13488462-G-T 11332786-G-T *
13488475-C-T 11332799-C-T *
4763687-A-AT 4895646-A-AT 24×T*
22694141-G-A 20532255-G-A FGC49054 Y*
58863010-T-C 56727861-A-G *
22509080-T-A 20347194-T-A DYZ19 *
13708660-C-T 11552984-C-T *
13388081-G-A 11232405-G-A *
58866655-T-C 56724216-A-G *
13489166-C-T 11333490-C-T *
58844635-C-G 56746236-G-C *
58912674-A-G 56678197-T-C *
13380527-T-TC 11224851-T-TC *
14260838-T-A 12140132-T-A Y*
14260852-A-T 12140146-A-T Y*
3143738-C-T 3275697-C-T *
58829318-C-T 56761553-G-A *
13686637-G-T 11530961-G-T *
16880621-G-GA 14768741-G-GA 9×A*
13488447-C-A 11332771-C-A *
13576724-C-T 11421048-C-T FT445677 *
8565786-AT-A 8697745-AT-A 10×T*
58833749-A-G 56757122-T-C *
58827198-T-C 56763673-A-G *
4552729-A-G 4684688-A-G FGC43855 *
58840813-T-A 56750058-A-T *
15676177-C-T 13564297-C-T FGC45927 Y*
23193369-G-GA 21031483-G-GA 10×A*
58829291-G-C 56761580-C-G *
22469332-G-C 20307446-G-C DYZ19 *
13714330-G-T 11558654-G-T *
58882418-G-A 56708453-C-T *
58866686-C-G 56724185-G-C *
9168647-AT-A 9331038-AT-A 9×T*
58979383-C-T 56833236-C-T *
58979386-T-A 56833239-T-A *
28815261-G-A 26669114-G-A *
22509112-C-T 20347226-C-T DYZ19 *
58979076-C-T 56832929-C-T *
13708636-A-T 11552960-A-T *
58985162-A-G 56839015-A-G *
59009532-G-A 56863385-G-A *
15248531-G-T 13136617-G-T FGC45159 Y*
26923270-A-G 24777123-A-G P1_r3 *
22255871-G-A 20093985-G-A DYZ19 *
58884367-C-T 56706504-G-A *
9942922-C-A 10105313-C-A Y*
5131101-C-A 5263060-C-A Z3121 *
5193932-G-A 5325891-G-A *
5639838-G-A 5771797-G-A FT407196 *
5878150-C-T 6010109-C-T 14×T*
6402575-G-T 6534534-G-T *
6607553-A-G 6739512-A-G *
9932524-C-T 10094915-C-T Y*
9942602-C-T 10104993-C-T Y*
9968880-G-A 10131271-G-A Y*
4712815-A-T 4844774-A-T *
13291559-A-G 11135883-A-G *
13291567-T-C 11135891-T-C *
13388083-A-C 11232407-A-C *
13420273-G-T 11264597-G-T *
13450880-C-CCACTCCACTCCTCTCCCCAA 11295204-C-CCACTCCACTCCTCTCCCCAA *
13463304-G-T 11307628-G-T *
13463770-C-CT 11308094-C-CT *
13576799-A-G 11421123-A-G *
13690735-A-C 11535059-A-C *
4982764-T-C 5114723-T-C *
4525721-C-A 4657680-C-A *
15791637-CAT-C 13679757-CAT-C *
4843273-G-A 4975232-G-A *
22790465-A-G 20628579-A-G CTS10818 Y*
13580857-C-T 11425181-C-T *
18050093-T-A 15938213-T-A YY*
58839815-C-T 56751056-G-A *
22489844-G-T 20327958-G-T DYZ19 *
58882549-A-C 56708322-T-G *
13701814-A-C 11546138-A-C *
58855913-A-T 56734958-T-A *
5479874-G-A 5611833-G-A *
4248689-T-C 4380648-T-C *
25715355-C-CT 23569208-C-CT P1_b3 10×T*
13486004-A-AC 11330328-A-AC *
14798163-C-CT 12686234-C-CT 9×T*
22435594-G-T 20273708-G-T DYZ19 *
22435596-C-A 20273710-C-A DYZ19 *
3560828-A-G 3692787-A-G *
3727085-C-G 3859044-C-G *
3727485-T-C 3859444-T-C *
3841528-G-A 3973487-G-A *
13701372-T-A 11545696-T-A *
59032459-G-A 56886312-G-A *
22255870-T-G 20093984-T-G BY188772 DYZ19 *
13712521-T-C 11556845-T-C *
13473489-G-C 11317813-G-C *
13487760-C-CAT 11332084-C-CAT *
13489176-A-G 11333500-A-G *
13500419-T-C 11344743-T-C *
13502167-C-T 11346491-C-T *
13502205-G-A 11346529-G-A *
13693710-A-G 11538034-A-G FT448793 *
13711539-G-A 11555863-G-A FT225401 *
13718593-A-G 11562917-A-G *
13473477-A-G 11317801-A-G *
13722868-A-T 11567192-A-T *
14095781-G-A 11975075-G-A FT53487 YY*
14420310-G-T 12299585-G-T ZS807 YY*
15516996-TA-T 13405116-TA-T 8×A*
16480170-G-A 14368290-G-A Y*
16503892-G-A 14392012-G-A FT305061 YY*
17618458-C-T 15506578-C-T FT124171 Y*
21741134-ATG-A 19579248-ATG-A *
22255839-G-C 20093953-G-C DYZ19 *
13473484-CA-C 11317808-CA-C *
13466968-C-T 11311292-C-T *
58844584-T-C 56746287-A-G *
6401062-A-G 6533021-A-G *
58866121-T-C 56724750-A-G *
13713209-G-A 11557533-G-A *
13313174-A-G 11157498-A-G PR1264 *
3727060-G-A 3859019-G-A *
4145833-TTC-T 4277792-TTC-T *
4742556-T-C 4874515-T-C *
4779748-T-C 4911707-T-C *
5580714-T-G 5712673-T-G *
5726124-A-T 5858083-A-T *
6402601-T-C 6534560-T-C F15181 *
13462712-G-A 11307036-G-A Z22920 *
7396568-AAAAC-A 7528527-AAAAC-A 5×AAAC*
9964235-C-G 10126626-C-G Y*
9964353-A-C 10126744-A-C Y*
13196224-T-G 11040548-T-G *
13196237-C-T 11040561-C-T FT440520 *
13260145-A-T 11104469-A-T *
13383095-T-G 11227419-T-G *
13420246-C-G 11264570-C-G *
13454841-C-A 11299165-C-A *
7002944-G-A 7134903-G-A Y*
4628923-A-G 4760882-A-G *
4701206-C-A 4833165-C-A *
21061666-G-T 18899780-G-T YY*
17425221-C-A 15313341-C-A YY*
5949474-C-A 6081433-C-A *
20840768-C-A 18678882-C-A P4_Gap *
17926954-AT-A 15815074-AT-A 9×T*
17030704-C-A 14918824-C-A YY*
4610179-C-A 4742138-C-A *
15141111-G-A 13029198-G-A YY*
17165494-C-A 15053614-C-A YY*
19267262-AT-A 17155382-AT-A *
28811085-G-A 26664938-G-A A4531 *
13469097-T-G 11313421-T-G *
22510157-T-C 20348271-T-C DYZ19 *
28813717-T-A 26667570-T-A *
28813736-C-G 26667589-C-G *
9940628-C-A 10103019-C-A Y*
2859987-CTTTTT-C 2991946-CTTTTT-C 16×T*
8262682-G-GA 8394641-G-GA 9×A*
18949661-C-A 16837781-C-A YY*
13480494-A-G 11324818-A-G *
28814800-A-T 26668653-A-T *
13696780-G-T 11541104-G-T *
21450481-C-A 19288595-C-A Y*
8698087-C-G 8830046-C-G YY*
13483290-C-A 11327614-C-A *
28531027-A-C 26384880-A-C *
23097177-G-T 20935291-G-T YY*
5949052-CAA-C 6081011-CAA-C 33×A*
18143768-C-T 16031888-C-T YY*
14097945-A-AT,ATT 11977239-A-AT,ATT 23×T*
19562716-C-A 17450836-C-A Y*
13976470-C-T 11855764-C-T FTA38935 Y*
4026665-C-CT 4158624-C-CT 9×T*
4581665-G-GT 4713624-G-GT 8×T*
13483395-A-T 11327719-A-T *
13690455-A-G 11534779-A-G *
13722818-G-C 11567142-G-C *
26433572-C-CT 24287425-C-CT P1_Y1 19×T*
13465072-G-A 11309396-G-A *
13485567-A-T 11329891-A-T *
13690462-T-C 11534786-T-C *
13722817-G-A 11567141-G-A *
24885602-C-T 22739455-C-T g1 *
13692486-A-C 11536810-A-C *
18413358-A-AT 16301478-A-AT P6_Gap 9×T*
9877813-C-A 10040204-C-A YY*
4653011-G-T 4784970-G-T *
28795861-A-C 26649714-A-C BY55580 *
13438425-T-A 11282749-T-A *
13474376-C-T 11318700-C-T *
13474393-G-C 11318717-G-C *
13483342-T-A 11327666-T-A *
13694871-G-C 11539195-G-C *
5786629-G-A 5918588-G-A *
15606409-C-A 13494529-C-A YY*
23585499-AT-A 21423613-AT-A 9×T*
13712698-G-A 11557022-G-A *
8268381-CT-C 8400340-CT-C 9×T*
17982087-C-A 15870207-C-A Y*
13405130-G-T 11249454-G-T *
13502221-A-G 11346545-A-G *
3684940-C-T 3816899-C-T *
10945658-C-A *
16413574-C-A 14301694-C-A YY*
13553114-C-A 11397438-C-A *
11034724-C-T FT45446 *
22509944-T-G 20348058-T-G DYZ19 *
13712579-G-T 11556903-G-T *
21456017-T-C 19294131-T-C YY*
7168587-C-A 7300546-C-A YY*
17018776-CT-C 14906896-CT-C *
9944004-C-A 10106395-C-A Y*
6731178-C-A 6863137-C-A YY*
21624499-C-A 19462613-C-A Y*
4636049-C-G 4768008-C-G *
7164323-C-A 7296282-C-A YY*
14355335-C-A 12234630-C-A YY*
26435086-C-G 24288939-C-G P1_Y1 *
17647550-AT-A 15535670-AT-A 9×T*
16836662-G-T 14724782-G-T YY*
13693599-G-A 11537923-G-A *
18915989-GTT-G 16804109-GTT-G 14×T*
21299135-C-A 19137249-C-A YY*
15659101-C-A 13547221-C-A YY*
13474328-G-T 11318652-G-T *
13485619-C-A 11329943-C-A *
13388227-A-G 11232551-A-G *
13388232-A-G 11232556-A-G *
13388239-G-C 11232563-G-C *
13474369-T-C 11318693-T-C *
21458018-AT-A 19296132-AT-A 8×T*
13700689-G-T 11545013-G-T *
22509284-A-G 20347398-A-G DYZ19 *
56834639-A-T *
17800319-C-CT 15688439-C-CT 9×T*
58916312-C-T 56674559-G-A *
58856639-T-G 56734232-A-C *
22422590-A-G 20260704-A-G DYZ19 *
22422614-T-A 20260728-T-A DYZ19 *
13466332-A-T 11310656-A-T *
58916462-C-G 56674409-G-C *
13480775-A-C 11325099-A-C *
5524917-CA-C 5656876-CA-C 9×A*
9964311-C-A 10126702-C-A Y*
6580080-T-C 6712039-T-C *
13462343-C-A 11306667-C-A *
16577633-C-A 14465753-C-A YY*
13474342-C-A 11318666-C-A *
6401120-A-T 6533079-A-T FT203724 *
4243583-C-A 4375542-C-A *
3652327-G-T 3784286-G-T *
8785021-G-T 8916980-G-T YY*
28814128-A-T 26667981-A-T *
13474445-C-A 11318769-C-A *
5593309-C-A 5725268-C-A 15×A*
28696723-GA-G 26550576-GA-G *
13474339-A-T 11318663-A-T *
13489277-AT-A 11333601-AT-A *
13474456-C-G 11318780-C-G *
58916237-C-A 56674634-G-T *
22509135-A-T 20347249-A-T DYZ19 *
17999245-G-A 15887365-G-A P7_Gap Y*
17526031-TA-T 15414151-TA-T 9×A*
13462640-G-A 11306964-G-A *
9398399-CA-C 9560790-CA-C 10×A*
22489835-C-G 20327949-C-G DYZ19 *
58856475-C-A 56734396-G-T *
22489850-T-C 20327964-T-C DYZ19 *
58844517-A-T 56746354-T-A *
16019397-G-GA 13907517-G-GA 10×A*
13693508-G-T 11537832-G-T *
22489873-C-T 20327987-C-T DYZ19 *
5193820-A-G 5325779-A-G *
13708494-C-G 11552818-C-G *
22489798-T-A 20327912-T-A DYZ19 *
58857101-C-T 56733770-G-A *
28696721-A-AC 26550574-A-AC *
28794223-G-T 26648076-G-T *
11018957-C-A *
13995782-C-CT 11875076-C-CT 9×T*
8128408-C-A 8260367-C-A YY*
5644612-C-A 5776571-C-A *
19449896-C-A 17338016-C-A YY*
10647794-C-A *
17633095-G-T 15521215-G-T YY*
2701207-C-A 2833166-C-A YY*
3620188-G-GT 3752147-G-GT 10×T*
4243653-G-A 4375612-G-A *
19558339-A-G 17446459-A-G Y*
22037415-T-TA 19875529-T-TA 10×A*
19547250-G-A 17435370-G-A FTB40641 YY*
7998985-GA-G 8130944-GA-G *
28618103-C-A 26471956-C-A Y*
15542675-T-A 13430795-T-A FTA28179 YY*
17032304-C-A 14920424-C-A YY*
10787958-A-AC *
8003209-G-GT 8135168-G-GT 9×T*
19537919-G-T 17426039-G-T YY*
17997448-G-T 15885568-G-T P7_Gap Y*
21087399-C-CAA 18925513-C-CAA 14×A*
28818407-C-T 26672260-C-T A4550 *
13483381-C-T 11327705-C-T *
13483380-G-A 11327704-G-A *
13718576-C-T 11562900-C-T *
13462321-C-A 11306645-C-A *
19206741-TAAAAA-T 17094861-TAAAAA-T 29×A*
18731500-C-A 16619620-C-A YY*
6539540-GA-G 6671499-GA-G 9×A*
4300722-CA-C 4432681-CA-C 9×A*
3610849-CT-C 3742808-CT-C 9×T*
3877506-G-T 4009465-G-T *
16821592-TAA-T 14709712-TAA-T 12×A*
15641785-AG-A 13529905-AG-A *
28721499-CAA-C 26575352-CAA-C 18×A*
16503578-C-A 14391698-C-A YY*
17716708-A-G 15604828-A-G YY*
7422435-CT-C 7554394-CT-C 9×T*
17674177-GTT-G 15562297-GTT-G 13×T*
5924390-C-A 6056349-C-A *
13468599-T-G 11312923-T-G *
5910764-G-T 6042723-G-T *
18723203-G-T 16611323-G-T YY*
21743138-G-T 19581252-G-T Y*
3525370-C-A 3657329-C-A *
3525454-AT-A 3657413-AT-A 8×T*
9508239-G-T 9670630-G-T *
7210812-C-T 7342771-C-T Y*
7177278-GT-G 7309237-GT-G *
7186215-T-C 7318174-T-C YY*
7187879-C-A 7319838-C-A YY*
7195585-G-T 7327544-G-T YY*
7203390-T-C 7335349-T-C YY*
7204082-G-T 7336041-G-T YY*
7204385-C-T 7336344-C-T YY*
7207629-A-G 7339588-A-G YY*
7255540-G-T 7387499-G-T Y*
7160828-TC-T 7292787-TC-T *
7256752-G-T 7388711-G-T Y*
7260171-G-T 7392130-G-T YY*
7261060-G-T 7393019-G-T YY*
7278035-C-A 7409994-C-A YY*
7286198-T-C 7418157-T-C YY*
7286230-T-C 7418189-T-C YY*
7298041-C-A 7430000-C-A Y*
7301701-G-C 7433660-G-C YY*
7301705-G-T 7433664-G-T YY*
7174210-G-A 7306169-G-A YY*
7157124-G-A 7289083-G-A YY*
7318852-A-G 7450811-A-G Y*
7099374-C-A 7231333-C-A YY*
6998846-C-G 7130805-C-G Y*
7009836-C-A 7141795-C-A YY*
7036125-A-G 7168084-A-G YY*
7043263-G-T 7175222-G-T Y*
7072127-C-A 7204086-C-A YY*
7078821-G-C 7210780-G-C YY*
7085582-G-T 7217541-G-T Y*
7085622-A-G 7217581-A-G Y*
7103651-T-C 7235610-T-C YY*
7154001-G-C 7285960-G-C YY*
7116234-AAAATAAATACATACAT-A 7248193-AAAATAAATACATACAT-A *
7120343-G-T 7252302-G-T Y*
7121504-C-A 7253463-C-A Y*
7134482-G-T 7266441-G-T Y*
7135735-G-T 7267694-G-T YY*
7137434-C-T 7269393-C-T BY204712 YY*
7139833-G-A 7271792-G-A YY*
7141254-GA-G 7273213-GA-G 10×A*
7147738-G-T 7279697-G-T YY*
7310283-T-C 7442242-T-C YY*
7319074-CTTGAATT-C 7451033-CTTGAATT-C *
6986406-C-A 7118365-C-A YY*
7631411-G-T 7763370-G-T Y*
7591183-CTT-C 7723142-CTT-C *
7598473-C-A 7730432-C-A YY*
7603395-C-A 7735354-C-A YY*
7603654-C-G 7735613-C-G YY*
7616457-G-T 7748416-G-T YY*
7621537-A-G 7753496-A-G Y*
7622650-T-C 7754609-T-C BY33114 YY*
7628973-G-A 7760932-G-A YY*
7650306-G-T 7782265-G-T YY*
7578678-C-T 7710637-C-T Y*
7654717-A-G 7786676-A-G YY*
7657898-C-A 7789857-C-A YY*
7663584-A-G 7795543-A-G YY*
7665411-T-A 7797370-T-A YY*
7679241-C-A 7811200-C-A YY*
7692459-G-T 7824418-G-T YY*
7692488-G-T 7824447-G-T YY*
7709752-G-A 7841711-G-A Y*
7729822-T-C 7861781-T-C YY*
7578685-G-T 7710644-G-T Y*
7573056-CT-C 7705015-CT-C *
7327037-A-G 7458996-A-G YY*
7422465-G-T 7554424-G-T YY*
7329790-G-T 7461749-G-T YY*
7333601-C-T 7465560-C-T YY*
7335257-G-T 7467216-G-T YY*
7348170-G-T 7480129-G-T YY*
7364751-C-A 7496710-C-A YY*
7368324-T-C 7500283-T-C YY*
7399353-C-A 7531312-C-A YY*
7412741-C-T 7544700-C-T YY*
7429914-C-T 7561873-C-T YY*
7572453-G-T 7704412-G-T YY*
7436981-TCAAAA-T 7568940-TCAAAA-T *
7444542-C-A 7576501-C-A Y*
7452402-C-T 7584361-C-T IR1_L *
7453417-T-C 7585376-T-C IR1_L *
7464037-CAAAA-C 7595996-CAAAA-C IR1_L 19×A*
7469967-C-G 7601926-C-G IR1_L *
7469986-C-A 7601945-C-A IR1_L *
7472888-A-G 7604847-A-G IR1_L *
7514623-C-A 7646582-C-A Y*
6993231-G-A 7125190-G-A YY*
6986216-G-C 7118175-G-C YY*
7742029-G-A 7873988-G-A YY*
6460011-A-G 6591970-A-G *
6410708-G-T 6542667-G-T *
6417441-CA-C 6549400-CA-C *
6419221-GA-G 6551180-GA-G *
6428886-A-G 6560845-A-G *
6438424-C-A 6570383-C-A *
6439286-G-A 6571245-G-A *
6442081-C-T 6574040-C-T *
6442948-G-A 6574907-G-A *
6463102-T-A 6595061-T-A *
6399486-G-A 6531445-G-A *
6467651-T-C 6599610-T-C *
6470180-C-A 6602139-C-A *
6472235-G-C 6604194-G-C *
6476233-C-A 6608192-C-A *
6481215-CCCATCAGACTG-C 6613174-CCCATCAGACTG-C *
6488259-T-C 6620218-T-C *
6496178-G-T 6628137-G-T *
6512230-G-A 6644189-G-A *
6518057-A-G 6650016-A-G *
6400656-C-T 6532615-C-T *
6396225-G-A 6528184-G-A *
6529239-T-C 6661198-T-C *
6149228-G-T 6281187-G-T IR3_Dst *
6087012-T-A 6218971-T-A *
6090032-C-A 6221991-C-A *
6114938-G-T 6246897-G-T *
6129269-C-A 6261228-C-A *
6133685-C-A 6265644-C-A *
6138059-T-C 6270018-T-C IR3_Dst *
6138086-A-G 6270045-A-G IR3_Dst *
6141895-G-C 6273854-G-C IR3_Dst *
6152179-G-T 6284138-G-T IR3_Dst *
6391965-C-A 6523924-C-A *
6157298-G-C 6289257-G-C IR3_Dst *
6171418-C-T 6303377-C-T IR3_Dst *
6200772-G-A 6332731-G-A IR3_Dst *
6204181-G-T 6336140-G-T IR3_Dst *
6225483-G-T 6357442-G-T IR3_Dst *
6359095-CAAA-C 6491054-CAAA-C 30×A*
6365722-T-C 6497681-T-C *
6383832-G-T 6515791-G-T *
6385333-A-T 6517292-A-T *
6529173-T-C 6661132-T-C *
6534433-C-T 6666392-C-T *
6965232-C-A 7097191-C-A YY*
6848395-C-A 6980354-C-A YY*
6788331-A-G 6920290-A-G YY*
6788379-TA-T 6920338-TA-T *
6793777-G-T 6925736-G-T YY*
6797176-CT-C 6929135-CT-C *
6806368-C-T 6938327-C-T YY*
6824575-C-T 6956534-C-T YY*
6829918-GA-G 6961877-GA-G *
6838896-C-A 6970855-C-A YY*
6849598-A-G 6981557-A-G YY*
6753252-G-C 6885211-G-C YY*
6850285-G-T 6982244-G-T YY*
6850589-A-G 6982548-A-G YY*
6866860-G-T 6998819-G-T YY*
6869977-C-T 7001936-C-T YY*
6885739-G-A 7017698-G-A YY*
6911097-A-G 7043056-A-G YY*
6918137-C-G 7050096-C-G YY*
6924183-A-T 7056142-A-T YY*
6962853-GA-G 7094812-GA-G *
6777698-G-T 6909657-G-T YY*
6752851-G-T 6884810-G-T YY*
6537783-C-T 6669742-C-T *
6638920-A-G 6770879-A-G Y*
6541608-G-T 6673567-G-T *
6575910-T-C 6707869-T-C *
6581256-G-T 6713215-G-T *
6581280-A-G 6713239-A-G *
6584782-G-C 6716741-G-C *
6597340-TAAAA-T 6729299-TAAAA-T 28×A*
6622785-C-A 6754744-C-A Y*
6627495-G-T 6759454-G-T YY*
6629852-A-G 6761811-A-G YY*
6640884-G-T 6772843-G-T Y*
6751181-G-C 6883140-G-C Y*
6671125-A-G 6803084-A-G YY*
6675001-C-A 6806960-C-A YY*
6688923-AG-A 6820882-AG-A *
6694642-T-C 6826601-T-C Y*
6696041-G-T 6828000-G-T YY*
6700491-G-T 6832450-G-T YY*
6717967-C-A 6849926-C-A YY*
6719636-T-G 6851595-T-G BY161032 YY*
6726896-G-A 6858855-G-A Y*
7730883-A-G 7862842-A-G YY*
7750128-C-G 7882087-C-G YY*
6061599-G-C 6193558-G-C *
8789317-A-T 8921276-A-T YY*
8728139-A-C 8860098-A-C YY*
8730318-G-A 8862277-G-A YY*
8735922-C-A 8867881-C-A Y*
8746198-C-CACAG 8878157-C-CACAG *
8775378-C-A 8907337-C-A YY*
8777970-C-A 8909929-C-A YY*
8778173-C-A 8910132-C-A YY*
8785130-G-A 8917089-G-A YY*
8803404-T-C 8935363-T-C YY*
8705001-T-C 8836960-T-C YY*
8804709-C-A 8936668-C-A YY*
8844131-C-A 8976090-C-A YY*
8850778-T-C 8982737-T-C Y*
8875413-C-A 9007372-C-A Y*
8892643-C-A 9024602-C-A Y*
8893066-G-C 9025025-G-C Y*
8895986-TC-T 9027945-TC-T *
8898944-G-T 9030903-G-T Y*
8909105-C-G 9041064-C-G *
8725890-G-T 8857849-G-T YY*
8702498-C-G 8834457-C-G YY*
8978335-CA-C 9140726-CA-C *
8613622-G-T 8745581-G-T YY*
8505116-G-T 8637075-G-T YY*
8516593-A-G 8648552-A-G YY*
8516766-G-A 8648725-G-A YY*
8538521-G-T 8670480-G-T YY*
8547101-TG-T 8679060-TG-T *
8547502-G-T 8679461-G-T YY*
8562935-G-T 8694894-G-T YY*
8593252-G-T 8725211-G-T YY*
8626727-G-T 8758686-G-T YY*
8701690-G-T 8833649-G-T YY*
8632193-C-G 8764152-C-G YY*
8639308-G-C 8771267-G-C YY*
8645146-CT-C 8777105-CT-C *
8666653-A-G 8798612-A-G YY*
8669300-A-G 8801259-A-G Y*
8671197-G-A 8803156-G-A YY*
8682025-G-T 8813984-G-T YY*
8691593-T-C 8823552-T-C YY*
8700462-C-A 8832421-C-A YY*
8968899-C-A 9131290-C-A *
8980775-C-A 9143166-C-A Y*
8485985-A-G 8617944-A-G FTB48035 YY*
13851031-G-A 11730325-G-A *
9388648-G-T 9551039-G-T Y*
9399455-C-G 9561846-C-G YY*
9399466-T-C 9561857-T-C YY*
9399511-A-G 9561902-A-G YY*
9408641-A-G 9571032-A-G YY*
9412050-G-A 9574441-G-A Y*
9422592-C-A 9584983-C-A YY*
9425341-G-T 9587732-G-T YY*
9429150-A-G 9591541-A-G Y*
9184629-G-T 9347020-G-T Y*
9432049-G-T 9594440-G-T Y*
9446827-C-A 9609218-C-A YY*
9452497-A-G 9614888-A-G YY*
9453537-A-G 9615928-A-G YY*
9460504-A-G 9622895-A-G YY*
9474915-AT-A 9637306-AT-A *
9478248-G-A 9640639-G-A *
9496425-C-A 9658816-C-A *
9497737-T-C 9660128-T-C *
9387442-CT-C 9549833-CT-C *
9178414-G-T 9340805-G-T Y*
8986430-G-T 9148821-G-T *
9083476-G-T 9245867-G-T Y*
8991163-G-T 9153554-G-T Y*
8991891-AT-A 9154282-AT-A 9×T*
8993865-G-T 9156256-G-T Y*
8994878-G-T 9157269-G-T Y*
8995217-C-T 9157608-C-T Y*
9015746-T-C 9178137-T-C Y*
9046623-G-T 9209014-G-T Y*
9080089-C-A 9242480-C-A *
9082428-G-A 9244819-G-A Y*
9085198-G-C 9247589-G-C Y*
9166506-G-T 9328897-G-T Y*
9094058-T-C 9256449-T-C Y*
9104082-A-T 9266473-A-T Y*
9104106-C-A 9266497-C-A Y*
9115495-C-A 9277886-C-A Y*
9123264-G-T 9285655-G-T Y*
9135369-G-T 9297760-G-T Y*
9146762-A-G 9309153-A-G Y*
9160927-GA-G 9323318-GA-G *
9166398-G-A 9328789-G-A Y*
8489030-A-G 8620989-A-G YY*
8452766-C-A 8584725-C-A YY*
7753573-G-C 7885532-G-C Y*
7969397-G-T 8101356-G-T Y*
7936257-A-T 8068216-A-T YY*
7942114-G-A 8074073-G-A YY*
7944241-GC-G 8076200-GC-G *
7956603-G-T 8088562-G-T YY*
7957461-C-A 8089420-C-A YY*
7960980-C-G 8092939-C-G YY*
7963519-G-A 8095478-G-A YY*
7965725-T-C 8097684-T-C Y*
7972118-C-G 8104077-C-G YY*
7918000-G-A 8049959-G-A Y*
7972855-CTTT-C 8104814-CTTT-C 12×T*
7977332-G-T 8109291-G-T YY*
7992970-T-C 8124929-T-C YY*
8001209-C-A 8133168-C-A YY*
8016987-G-T 8148946-G-T YY*
8020598-C-T 8152557-C-T YY*
8024392-C-A 8156351-C-A YY*
8026346-A-G 8158305-A-G YY*
8043637-G-T 8175596-G-T Y*
7922378-C-G 8054337-C-G YY*
7901912-A-G 8033871-A-G YY*
8043733-T-C 8175692-T-C Y*
7844868-C-T 7976827-C-T YY*
7795783-G-A 7927742-G-A YY*
7802962-G-GAA 7934921-G-GAA 12×A*
7807159-A-G 7939118-A-G YY*
7810104-G-T 7942063-G-T YY*
7822421-G-T 7954380-G-T YY*
7824445-G-T 7956404-G-T YY*
7826170-C-A 7958129-C-A YY*
7840465-G-T 7972424-G-T YY*
7851941-A-G 7983900-A-G YY*
7889053-G-T 8021012-G-T YY*
7853696-C-G 7985655-C-G YY*
7858828-A-G 7990787-A-G YY*
7858864-C-A 7990823-C-A YY*
7859733-AT-A 7991692-AT-A *
7861005-C-A 7992964-C-A Y*
7861575-G-T 7993534-G-T Y*
7869272-A-G 8001231-A-G YY*
7871508-A-G 8003467-A-G YY*
7884530-C-T 8016489-C-T YY*
8043699-G-C 8175658-G-C Y*
8061334-C-A 8193293-C-A YY*
8450420-C-A 8582379-C-A YY*
8373681-CCAATCTGTG-C 8505640-CCAATCTGTG-C *
8284303-C-T 8416262-C-T YY*
8295740-G-T 8427699-G-T Y*
8300578-G-A 8432537-G-A YY*
8312961-G-T 8444920-G-T YY*
8317836-G-T 8449795-G-T YY*
8345147-CT-C 8477106-CT-C *
8357526-G-A 8489485-G-A YY*
8360072-C-T 8492031-C-T YY*
8376208-G-T 8508167-G-T YY*
8243476-C-G 8375435-C-G YY*
8394613-G-T 8526572-G-T YY*
8402733-A-T 8534692-A-T YY*
8403423-G-T 8535382-G-T YY*
8405588-G-T 8537547-G-T YY*
8415325-A-G 8547284-A-G YY*
8417315-G-T 8549274-G-T YY*
8423120-C-A 8555079-C-A YY*
8445860-A-G 8577819-A-G FT233899 YY*
8448929-C-A 8580888-C-A YY*
8249348-A-G 8381307-A-G YY*
8234882-G-T 8366841-G-T YY*
8067190-C-G 8199149-C-G YY*
8119436-G-T 8251395-G-T YY*
8068120-C-T 8200079-C-T YY*
8071805-C-A 8203764-C-A YY*
8082399-T-C 8214358-T-C YY*
8083539-C-A 8215498-C-A YY*
8091200-G-T 8223159-G-T Y*
8093968-G-A 8225927-G-A YY*
8104643-A-G 8236602-A-G YY*
8115123-A-G 8247082-A-G YY*
8117452-A-T 8249411-A-T YY*
8140154-C-A 8272113-C-A YY*
8217722-T-C 8349681-T-C YY*
8153123-G-T 8285082-G-T YY*
8170865-T-C 8302824-T-C YY*
8187929-C-A 8319888-C-A YY*
8192356-T-A 8324315-T-A YY*
8194057-G-A 8326016-G-A YY*
8194407-A-T 8326366-A-T YY*
8207930-C-T 8339889-C-T YY*
8213560-G-A 8345519-G-A YY*
8217641-C-A 8349600-C-A YY*
6073248-G-T 6205207-G-T *
6060621-G-T 6192580-G-T *
3527248-C-A 3659207-C-A *
4427770-G-T 4559729-G-T *
4343121-C-A 4475080-C-A *
4347380-C-A 4479339-C-A *
4352637-C-A 4484596-C-A *
4355166-C-A 4487125-C-A *
4382744-T-A 4514703-T-A *
4383172-G-T 4515131-G-T *
4392468-C-A 4524427-C-A *
4424377-GTTTTT-G 4556336-GTTTTT-G 18×T*
4427792-G-T 4559751-G-T *
4335171-G-A 4467130-G-A *
4440944-T-C 4572903-T-C *
4443817-A-G 4575776-A-G *
4453330-C-A 4585289-C-A *
4455981-G-T 4587940-G-T *
4460075-T-A 4592034-T-A *
4463045-G-T 4595004-G-T *
4476828-G-T 4608787-G-T *
4483607-C-A 4615566-C-A *
4483871-C-A 4615830-C-A FTA54488 *
4337251-C-A 4469210-C-A *
4332200-G-C 4464159-G-C *
4503505-G-T 4635464-G-T *
4211704-CA-C 4343663-CA-C 8×A*
4164984-A-T 4296943-A-T *
4171837-G-C 4303796-G-C *
4173501-G-T 4305460-G-T *
4182377-C-A 4314336-C-A *
4192114-C-G 4324073-C-G *
4197581-CA-C 4329540-CA-C *
4201382-GAA-G 4333341-GAA-G 11×A*
4210143-G-T 4342102-G-T *
4214662-C-A 4346621-C-A *
4332143-G-A 4464102-G-A *
4220204-C-T 4352163-C-T *
4220395-GA-G 4352354-GA-G *
4244233-T-C 4376192-T-C *
4259065-T-C 4391024-T-C *
4294614-G-T 4426573-G-T *
4297088-CT-C 4429047-CT-C *
4299771-T-C 4431730-T-C *
4303512-C-A 4435471-C-A *
4329514-C-T 4461473-C-T *
4494939-G-T 4626898-G-T *
4505664-A-G 4637623-A-G *
4131268-G-T 4263227-G-T *
4761934-AACATCCTTCC-A 4893893-AACATCCTTCC-A *
4707059-TC-T 4839018-TC-T *
4716112-G-T 4848071-G-T *
4719571-G-T 4851530-G-T *
4727368-G-A 4859327-G-A *
4735113-C-A 4867072-C-A *
4736417-G-A 4868376-G-A *
4739194-G-A 4871153-G-A *
4741605-C-A 4873564-C-A *
4765268-T-C 4897227-T-C *
4681794-G-C 4813753-G-C *
4767435-A-G 4899394-A-G *
4767593-A-ATT 4899552-A-ATT 12×T*
4778037-G-T 4909996-G-T *
4778307-C-A 4910266-C-A *
4790009-C-A 4921968-C-A *
4790131-C-A 4922090-C-A *
4791289-T-C 4923248-T-C *
4801312-G-A 4933271-G-A *
4803315-CTTTT-C 4935274-CTTTT-C 13×T*
4704808-G-C 4836767-G-C *
4681745-T-C 4813704-T-C *
4518550-G-A 4650509-G-A *
4600621-A-G 4732580-A-G *
4521977-T-C 4653936-T-C *
4536267-T-C 4668226-T-C *
4537586-C-CTTT 4669545-C-CTTT 21×T*
4542905-A-G 4674864-A-G *
4549083-G-T 4681042-G-T *
4565968-C-A 4697927-C-A *
4580338-A-G 4712297-A-G FT52287 *
4582655-AT-A 4714614-AT-A 8×T*
4593021-C-T 4724980-C-T *
4609345-G-C 4741304-G-C *
4678725-C-A 4810684-C-A *
4609560-G-T 4741519-G-T *
4620881-C-A 4752840-C-A *
4624716-CA-C 4756675-CA-C *
4635231-T-C 4767190-T-C *
4641549-A-G 4773508-A-G *
4646270-G-T 4778229-G-T *
4656508-A-G 4788467-A-G *
4672761-G-T 4804720-G-T *
4673977-TTCC-T 4805936-TTCC-T *
4154815-G-T 4286774-G-T *
4130875-C-T 4262834-C-T *
4813525-A-G 4945484-A-G *
3706137-C-A 3838096-C-A *
3654873-C-G 3786832-C-G *
3659236-C-A 3791195-C-A *
3665040-G-T 3796999-G-T *
3674663-C-A 3806622-C-A *
3680339-C-T 3812298-C-T FT88356 *
3681094-A-C 3813053-A-C *
3686440-T-C 3818399-T-C *
3698772-G-A 3830731-G-A FTB27003 *
3711312-A-G 3843271-A-G *
3653971-G-T 3785930-G-T *
3719441-AT-A 3851400-AT-A *
3726345-T-C 3858304-T-C *
3726858-A-G 3858817-A-G *
3730689-C-A 3862648-C-A *
3731311-C-A 3863270-C-A *
3733299-C-G 3865258-C-G *
3734030-C-A 3865989-C-A *
3734041-T-C 3866000-T-C *
3734310-G-T 3866269-G-T *
3654113-G-T 3786072-G-T *
3652688-C-A 3784647-C-A *
3738354-C-A 3870313-C-A *
3583786-G-T 3715745-G-T *
3533610-G-T 3665569-G-T *
3534165-C-T 3666124-C-T *
3541509-T-C 3673468-T-C *
3545190-G-T 3677149-G-T *
3549632-T-C 3681591-T-C *
3554980-A-T 3686939-A-T *
3569373-C-A 3701332-C-A *
3570203-A-AT 3702162-A-AT *
3587513-AGG-A 3719472-AGG-A *
3649391-GATCTTAT-G 3781350-GATCTTAT-G *
3587525-T-C 3719484-T-C *
3587556-G-A 3719515-G-A *
3593991-A-G 3725950-A-G *
3594924-G-A 3726883-G-A FT265382 *
3606121-T-C 3738080-T-C *
3606806-C-A 3738765-C-A *
3607965-G-T 3739924-G-T *
3610806-C-T 3742765-C-T *
3642534-C-A 3774493-C-A *
3734319-G-T 3866278-G-T *
3740876-T-C 3872835-T-C *
4123185-G-C 4255144-G-C *
4022168-C-A 4154127-C-A *
3966478-C-A 4098437-C-A *
3972273-AG-A 4104232-AG-A *
3984666-G-T 4116625-G-T *
3988939-G-T 4120898-G-T *
3992461-C-A 4124420-C-A *
3993302-C-G 4125261-C-G *
3995919-C-A 4127878-C-A *
3996455-G-GAA 4128414-G-GAA 10×A*
4023212-C-T 4155171-C-T *
3954487-C-A 4086446-C-A *
4027607-C-A 4159566-C-A *
4034582-T-C 4166541-T-C *
4064260-C-T 4196219-C-T *
4076618-T-C 4208577-T-C *
4097038-T-C 4228997-T-C *
4116065-C-G 4248024-C-G *
4116093-G-T 4248052-G-T *
4121238-G-A 4253197-G-A *
4122502-G-T 4254461-G-T *
3960864-T-C 4092823-T-C *
3951626-C-A 4083585-C-A *
3758204-C-A 3890163-C-A *
3878341-G-T 4010300-G-T *
3758405-T-C 3890364-T-C *
3760393-ATAAAGACAGAT-A 3892352-ATAAAGACAGAT-A *
3763167-C-T 3895126-C-T FT370224 *
3781724-A-G 3913683-A-G *
3785078-A-G 3917037-A-G *
3794558-A-G 3926517-A-G *
3799185-G-T 3931144-G-T *
3821947-T-C 3953906-T-C *
3859840-A-G 3991799-A-G *
3880695-C-A 4012654-C-A *
3940401-G-A 4072360-G-A *
3882003-G-T 4013962-G-T *
3893717-T-C 4025676-T-C *
3896516-C-A 4028475-C-A *
3908917-C-T 4040876-C-T *
3908918-A-G 4040877-A-G *
3908938-A-G 4040897-A-G *
3918339-G-A 4050298-G-A *
3928184-T-C 4060143-T-C *
3938078-C-A 4070037-C-A *
4806920-C-T 4938879-C-T *
4822898-G-T 4954857-G-T *
6060446-A-G 6192405-A-G *
5687349-G-T 5819308-G-T *
5606345-T-C 5738304-T-C *
5609691-G-T 5741650-G-T *
5623921-C-A 5755880-C-A *
5627229-C-A 5759188-C-A *
5643855-AT-A 5775814-AT-A *
5649081-A-G 5781040-A-G *
5655714-G-C 5787673-G-C *
5668218-G-T 5800177-G-T *
5693458-C-T 5825417-C-T *
5596488-T-C 5728447-T-C *
5697500-T-C 5829459-T-C *
5698795-C-A 5830754-C-A *
5699359-G-T 5831318-G-T *
5702325-G-T 5834284-G-T *
5703230-A-G 5835189-A-G *
5720315-G-T 5852274-G-T *
5721381-G-T 5853340-G-T *
5726105-A-T 5858064-A-T *
5731400-T-C 5863359-T-C *
5598402-C-A 5730361-C-A *
5593520-G-T 5725479-G-T *
5740136-G-T 5872095-G-T *
5518204-T-C 5650163-T-C *
5451396-C-A 5583355-C-A *
5454532-C-T 5586491-C-T FT136588 *
5456673-C-A 5588632-C-A *
5472756-C-A 5604715-C-A *
5491158-C-A 5623117-C-A FT114442 *
5496880-G-T 5628839-G-T *
5509592-G-T 5641551-G-T *
5517595-G-T 5649554-G-T *
5525471-C-A 5657430-C-A *
5586834-A-G 5718793-A-G *
5525943-C-A 5657902-C-A *
5530004-G-C 5661963-G-C *
5538892-C-A 5670851-C-A *
5539387-A-G 5671346-A-G *
5551982-C-A 5683941-C-A *
5556693-G-T 5688652-G-T *
5568973-T-C 5700932-T-C *
5580683-A-T 5712642-A-T *
5585652-G-T 5717611-G-T *
5732255-G-T 5864214-G-T FT121057 *
5743826-C-A 5875785-C-A *
5438871-CCAATAAA-C 5570830-CCAATAAA-C *
6003379-G-T 6135338-G-T FT238869 *
5965341-C-A 6097300-C-A *
5968005-G-T 6099964-G-T *
5971133-C-T 6103092-C-T *
5971906-G-T 6103865-G-T *
5978114-C-T 6110073-C-T *
5986423-T-C 6118382-T-C *
5987330-G-T 6119289-G-T *
5988728-A-G 6120687-A-G *
6015366-T-C 6147325-T-C *
5959569-G-A 6091528-G-A *
6020829-T-C 6152788-T-C *
6021046-CTTTAGATTTTA-C 6153005-CTTTAGATTTTA-C *
6026923-A-G 6158882-A-G *
6038721-G-T 6170680-G-T FT114896 *
6040968-C-A 6172927-C-A *
6042423-C-A 6174382-C-A *
6044414-A-C 6176373-A-C *
6051400-C-T 6183359-C-T *
6059092-CAAAAAA-C,CAAA 6191051-CAAAAAA-C,CAAA 25×A*
5960059-T-C 6092018-T-C *
5957755-GA-G 6089714-GA-G 8×A*
5746304-C-T 5878263-C-T *
5821417-C-A 5953376-C-A *
5763516-G-C 5895475-G-C *
5764839-T-C 5896798-T-C *
5769461-C-G 5901420-C-G *
5785876-G-T 5917835-G-T *
5789722-G-A 5921681-G-A *
5798885-C-A 5930844-C-A *
5804864-C-T 5936823-C-T *
5807234-A-T 5939193-A-T *
5819147-G-T 5951106-G-T *
5835112-C-A 5967071-C-A *
5944239-T-C 6076198-T-C *
5852910-A-G 5984869-A-G *
5863444-C-A 5995403-C-A *
5865895-G-T 5997854-G-T *
5888065-T-C 6020024-T-C *
5888957-T-C 6020916-T-C *
5919341-C-T 6051300-C-T *
5925224-T-C 6057183-T-C *
5927385-T-C 6059344-T-C *
5930333-G-T 6062292-G-T *
5446087-C-G 5578046-C-G *
5415594-T-C 5547553-T-C *
4826318-C-T 4958277-C-T *
5030657-CTA-C 5162616-CTA-C *
4993522-T-C 5125481-T-C *
4997502-ATACC-A 5129461-ATACC-A *
5002208-C-A 5134167-C-A *
5007139-A-G 5139098-A-G *
5008859-T-C 5140818-T-C *
5009457-G-T 5141416-G-T *
5018611-G-T 5150570-G-T *
5024252-G-T 5156211-G-T *
5039665-C-A 5171624-C-A *
4975986-G-C 5107945-G-C *
5041675-A-G 5173634-A-G *
5044913-A-G 5176872-A-G *
5055977-A-G 5187936-A-G *
5058266-GGA-G 5190225-GGA-G *
5062720-T-A 5194679-T-A *
5062750-G-A 5194709-G-A *
5062754-T-C 5194713-T-C *
5068295-G-A 5200254-G-A *
5081412-G-A 5213371-G-A *
4975987-C-A 5107946-C-A *
4968832-T-C 5100791-T-C *
5092089-T-C 5224048-T-C *
4863047-T-C 4995006-T-C *
4829066-G-T 4961025-G-T *
4830591-T-A 4962550-T-A *
4836872-G-A 4968831-G-A *
4842155-C-A 4974114-C-A *
4845371-G-T 4977330-G-T *
4857363-C-G 4989322-C-G *
4857962-C-A 4989921-C-A *
4861592-A-G 4993551-A-G *
4879337-C-A 5011296-C-A *
4966872-C-T 5098831-C-T *
4898635-G-A 5030594-G-A *
4905567-A-G 5037526-A-G *
4911598-T-A 5043557-T-A *
4926836-G-A 5058795-G-A *
4927718-C-A 5059677-C-A *
4935979-G-A 5067938-G-A *
4935986-G-A 5067945-G-A *
4935994-A-C 5067953-A-C *
4956590-G-T 5088549-G-T *
5091520-C-T 5223479-C-T *
5100500-G-T 5232459-G-T *
5407914-T-C 5539873-T-C *
5382827-T-C 5514786-T-C *
5322231-C-A 5454190-C-A *
5324997-C-T 5456956-C-T *
5332785-G-T 5464744-G-T *
5340022-A-G 5471981-A-G *
5347402-C-A 5479361-C-A *
5347482-T-C 5479441-T-C *
5369155-G-T 5501114-G-T *
5376866-G-C 5508825-G-C *
5383233-C-A 5515192-C-A *
5301232-G-T 5433191-G-T *
5387430-C-CAAA 5519389-C-CAAA 18×A*
5388510-C-A 5520469-C-A *
5391931-G-T 5523890-G-T *
5394319-T-C 5526278-T-C *
5399397-G-T 5531356-G-T FT126041 *
5400164-C-A 5532123-C-A *
5402746-G-T 5534705-G-T *
5404806-T-C 5536765-T-C *
5406681-G-T 5538640-G-T *
5312497-A-G 5444456-A-G *
5298527-C-A 5430486-C-A *
5100690-G-T 5232649-G-T *
5204145-G-T 5336104-G-T *
5104316-A-G 5236275-A-G *
5105722-T-C 5237681-T-C *
5106546-A-T 5238505-A-T *
5132259-C-A 5264218-C-A *
5150813-G-A 5282772-G-A *
5162340-C-A 5294299-C-A *
5173400-T-G 5305359-T-G *
5175664-C-G 5307623-C-G *
5197994-C-T 5329953-C-T *
5204166-T-C 5336125-T-C FT241543 *
5297995-G-T 5429954-G-T *
5205842-C-T 5337801-C-T *
5229628-T-C 5361587-T-C *
5239487-C-A 5371446-C-A *
5248943-C-T 5380902-C-T *
5252939-CAA-C 5384898-CAA-C 10×A*
5253666-C-A 5385625-C-A *
5256180-T-C 5388139-T-C *
5259592-G-T 5391551-G-T *
5290102-T-A 5422061-T-A *
35462-G-T *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 5600180106869616164257103869378392985
Used in age calculations16164257103869378392985
Counts of SNPs13661041
Variant counts last updated 2022-05-11 02:52:06.



Big Tree Main Page