Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z2959 > Z46375 > DF106 > DF104 > DF105 > A18726 > A259 > Y19870 > BY13838 > BY11722 > BY11723 > A884 > A885 > A887 > BY21239 > Y54272

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-Nebula
YF89574
10520846-G-A +
56677884-G-T +
16940719-C-T 14828839-C-T YY+
58912889-A-G 56677982-T-C +
17899086-G-T 15787206-G-T Y+
23169239-G-A 21007353-G-A Y+
24910853-C-CATATATAT 22764706-C-CATATATAT g1 26×AT+
56677946-A-G +
11028340-T-TTCAC +
56753060-G-C +
58913614-A-T 56677257-T-A +
36453-T-G FGC77518 +
56876147-A-T +
19459722-T-C 17347842-T-C Y+
58912878-G-A 56677993-C-T +
21958140-G-A 19796254-G-A Y+
18006687-A-AATT 15894807-A-AATT P7_Gap 11×ATT+
9947003-T-C 10109394-T-C Y+
21779844-G-A 19617958-G-A Y87371Y107473 YY+
56767286-G-C +
22540538-G-GTATATA 20378652-G-GTATATA 17×TA+
5254160-G-C 5386119-G-C FT17357 +
10789315-AATTCCATTCCATTCC-A +
58890270-C-G 56700601-G-C +
4306869-T-G 4438828-T-G +
10866325-TCCACA-T +
4551963-C-T 4683922-C-T FT33330 +
28478010-T-A 26331863-T-A +
8216526-T-C 8348485-T-C YY+
14816153-TA-T 12704224-TA-T +
24420879-A-AT 22274732-A-AT 43×T+
13331668-C-T 11175992-C-T +
16548288-G-A 14436408-G-A YY+
13700750-T-TATGGA 11545074-T-TATGGA *
13494553-T-A 11338877-T-A *
22509072-A-T 20347186-A-T DYZ19 *
22509064-G-T 20347178-G-T DYZ19 *
56756621-A-G *
23415298-ATG-A,A 21253412-ATG-A,A *
22508982-T-C 20347096-T-C DYZ19 *
56697037-G-T *
13480237-G-A 11324561-G-A *
13469703-A-T 11314027-A-T *
13697402-GGAGGC-G 11541726-GGAGGC-G *
6012416-C-T 6144375-C-T *
6012430-C-T 6144389-C-T *
58979405-T-TTCCAC 56833258-T-TTCCAC *
13487310-T-C 11331634-T-C *
13444595-C-A 11288919-C-A *
15324565-T-A 13212683-T-A YY*
13489773-C-G 11334097-C-G *
13487944-G-A 11332268-G-A *
13486498-G-A 11330822-G-A *
13469779-T-C 11314103-T-C *
13469775-T-C 11314099-T-C *
13469773-A-C 11314097-A-C *
13469749-C-T 11314073-C-T *
13469748-G-T 11314072-G-T *
13465310-T-A 11309634-T-A *
13444577-C-T 11288901-C-T *
6012479-T-C 6144438-T-C *
13412908-C-T 11257232-C-T *
11033031-C-A *
11033030-G-C *
13489029-T-G 11333353-T-G *
11033006-GAATTCACACCA-G *
11032985-CAATTCCATTACCTTCAATT-C *
10690883-C-T *
10690877-C-G *
6012491-ATTTTG-A 6144450-ATTTTG-A *
6012481-C-G 6144440-C-G *
13494551-T-TA 11338875-T-TA *
13486322-A-G 11330646-A-G *
13487402-C-T 11331726-C-T *
13462000-C-T 11306324-C-T *
22447399-T-A 20285513-T-A DYZ19 *
22436483-GAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G 20274597-GAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G DYZ19 *
22436456-GCAGGTTCATGGGCTTGCTCACTT-G 20274570-GCAGGTTCATGGGCTTGCTCACTT-G DYZ19 *
22430305-T-G 20268419-T-G DYZ19 *
22430299-T-TA 20268413-T-TA DYZ19 *
13489615-ACC-A,ATCC 11333939-ACC-A,ATCC *
13476847-G-T 11321171-G-T *
13489885-C-CG 11334209-C-CG *
13487988-C-A 11332312-C-A *
13470482-G-A 11314806-G-A *
56876123-GCAAAAAAAAAAAAAAAAAAAAAA-G *
56721425-A-T *
22289322-C-T 20127436-C-T DYZ19 *
22289319-G-T 20127433-G-T DYZ19 *
22289314-T-C 20127428-T-C DYZ19 *
13723006-T-G 11567330-T-G BY89833 *
13695709-T-A 11540033-T-A *
13695699-AG-A 11540023-AG-A *
13695695-C-G 11540019-C-G *
13695681-A-C 11540005-A-C *
22447403-C-T 20285517-C-T DYZ19 *
13461914-G-C 11306238-G-C *
13449142-A-AGTC 11293466-A-AGTC *
13478484-T-C 11322808-T-C *
13449038-CACT-C 11293362-CACT-C *
13257166-T-C 11101490-T-C *
10022429-A-G 10184820-A-G Y*
10022422-G-C 10184813-G-C Y*
56829980-T-TTCCAC *
13489887-AG-A,CG 11334211-AG-A,CG *
13489852-G-C 11334176-G-C *
13486304-C-A 11330628-C-A *
13480234-G-A 11324558-G-A *
13473218-G-T 11317542-G-T *
13708485-G-GTA 11552809-G-GTA *
13473200-C-G 11317524-C-G *
13473190-T-G 11317514-T-G *
13470599-G-T 11314923-G-T *
13467880-GTGATCAGTGCAGAGATTTGTCAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGT-G 11312204-GTGATCAGTGCAGAGATTTGTCAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGT-G *
13467452-G-A 11311776-G-A *
13467450-G-C 11311774-G-C *
13464679-A-T 11309003-A-T *
13487760-C-CCAA 11332084-C-CCAA *
13463964-G-A 11308288-G-A *
13439611-C-T 11283935-C-T *
28809824-T-G 26663677-T-G *
13470030-G-A 11314354-G-A *
56836141-C-CTTCCT *
13467416-A-T 11311740-A-T *
13690671-TC-T 11534995-TC-T *
13954355-A-T 11833649-A-T FTB33013 Y*
13954354-A-G 11833648-A-G FTB33012 Y*
56835188-CCACTT- *
22510662-C-T 20348776-C-T DYZ19 *
22510631-G-A 20348745-G-A DYZ19 *
13692968-T-A 11537292-T-A *
13471553-C-CG 11315877-C-CG *
13471550-C-G 11315874-C-G *
13467382-G-T 11311706-G-T *
56834400-C-CCACTCCAT *
13463228-G-T 11307552-G-T *
11307508-A- *
11293418-A- *
13449090-CTCCAT-C 11293414-CTCCAT-C *
10022452-C-T 10184843-C-T Y*
10022444-G-GCC 10184835-G-GCC *
10022441-CCT-C 10184832-CCT-C *
9992700-T-C 10155091-T-C Y*
9992638-G-T 10155029-G-T Y*
13690677-G-A 11535001-G-A BY88628 *
9962655-G-A 10125046-G-A Y*
56678153-T-C,C *
13469331-G-A 11313655-G-A *
5009426-G-A 5141385-G-A *
5009192-C-T 5141151-C-T *
5009181-C-A 5141140-C-A *
4826400-T-TTA,TTATA 4958359-T-TTA,TTATA 22×TA*
2788819-A-T 2920778-A-T Y*
2770036-T-A 2901995-T-A Y*
13469359-T-G 11313683-T-G *
13469353-C-G 11313677-C-G *
13469344-G-A 11313668-G-A *
13721271-G-T 11565595-G-T *
13462433-A-G 11306757-A-G *
13467618-G-C 11311942-G-C *
13443414-AAAAAC-A 11287738-AAAAAC-A 4×AAAAC*
11334057-C- *
13465149-T-C 11309473-T-C *
56834615-C-CTCCACTCCTCTCCACTCCAT *
28812476-T-TGA 26666329-T-TGA *
22511382-T-G 20349496-T-G DYZ19 *
13708444-T-A 11552768-T-A *
13482864-G-C 11327188-G-C *
11322671-C- *
6402330-C-G 6534289-C-G *
28797560-A-C 26651413-A-C *
13462475-T-G 11306799-T-G *
6403163-CGACGTATATGTTATATTCGTCGGTGTCGTAAAATACT-C 6535122-CGACGTATATGTTATATTCGTCGGTGTCGTAAAATACT-C *
10093656-T-C 10256047-T-C *
10093652-C-T 10256043-C-T *
10093624-C-G 10256015-C-G *
10093603-A-T 10255994-A-T *
10093599-G-A 10255990-G-A *
10093598-T-C 10255989-T-C *
10093577-A-G 10255968-A-G *
9985194-T-C 10147585-T-C Y*
9985193-G-T 10147584-G-T Y*
56856797-G-T *
10093671-G-T 10256062-G-T *
56856795-T-TATATTAAA *
11333950-CCA- *
13488635-A-G 11332959-A-G *
13469792-A-C 11314116-A-C *
13461904-C-A 11306228-C-A *
56831844-A- *
13469083-A-G 11313407-A-G *
11349373-A- *
11333036-C- *
10093662-A-T 10256053-A-T *
10093693-C-T 10256084-C-T FT427509 *
28797542-T-A 26651395-T-A *
13467340-C-A 11311664-C-A *
28797540-A-G 26651393-A-G *
22507821-A-T 20345935-A-T DYZ19 *
22270457-G-T 20108571-G-T DYZ19 *
13490340-T-TGAACTCATCATTTTTTATGGC 11334664-T-TGAACTCATCATTTTTTATGGC *
13489640-C-CCCAAT 11333964-C-CCCAAT *
13489565-A-C 11333889-A-C *
11333879-C- *
11333163-CGGTTG- *
11327714-G- *
13467337-G-T 11311661-G-T *
10093711-T-G 10256102-T-G *
13465218-G-A 11309542-G-A *
13465183-G-T 11309507-G-T *
13465153-G-C 11309477-G-C *
13462496-T-A 11306820-T-A *
13462487-C-G 11306811-C-G *
13462481-G-T 11306805-G-T *
13462394-G-T 11306718-G-T *
13462364-C-G 11306688-C-G *
13423063-TTAAC-T 11267387-TTAAC-T *
10988620-C-A *
13695669-T-C 11539993-T-C *
13447524-CACTA-C 11291848-CACTA-C *
13488629-T-G 11332953-T-G *
56838241-C-T *
13460924-A-ATC 11305248-A-ATC *
13351971-A-G 11196295-A-G *
13287958-T-TATA 11132282-T-TATA *
13205596-AT-A,A 11049920-AT-A,A *
10626567-C-A *
10034431-GAT-G 10196822-GAT-G *
9994892-TA-T 10157283-TA-T *
9983993-G-A 10146384-G-A Y*
9983992-T-C 10146383-T-C Y*
56830278-C-CCTTCCATTACACTCCACTCA *
13466224-A-G 11310548-A-G *
56829850-CCA-C *
13708442-C-T 11552766-C-T *
13688469-A-C 11532793-A-C *
13490007-T-C 11334331-T-C *
13489987-A-C 11334311-A-C *
13489886-C-A 11334210-C-A *
13489762-C-T 11334086-C-T *
13489758-G-GACA 11334082-G-GACA *
13489701-CCG-C 11334025-CCG-C *
13489407-G-C 11333731-G-C *
13466213-A-T 11310537-A-T *
13471610-G-A 11315934-G-A *
13487833-T-A 11332157-T-A *
56746050-A-T *
10034359-C-T 10196750-C-T Y*
10034358-C-T 10196749-C-T Y*
10034330-C-T 10196721-C-T Y*
10034323-A-G 10196714-A-G Y*
10034321-C-T 10196712-C-T Y*
5308801-G-T,T 5440760-G-T,T *
56874786-C-CTTTTTTTTTTTT 11×T*
56860676-A-ACACACAC *
56746066-G-C *
56724504-G-T *
13471621-C-T 11315945-C-T *
56724503-G-T *
56676593-A-G *
13707399-A-T 11551723-A-T *
13707392-ACCATT-A 11551716-ACCATT-A *
13488845-C-CAT 11333169-C-CAT *
13488363-A-T 11332687-A-T *
13479096-C-T 11323420-C-T *
13476599-A-T 11320923-A-T *
13476594-T-C 11320918-T-C *
13471636-T-G 11315960-T-G *
13488245-G-C 11332569-G-C *
13475989-C-G 11320313-C-G *
10034370-GA-G 10196761-GA-G *
13487953-C-A 11332277-C-A *
13748439-AC-A 11592763-AC-A *
13701341-C-A 11545665-C-A *
13697167-T-C 11541491-T-C *
13489689-G-GCA 11334013-G-GCA *
13488833-G-C 11333157-G-C *
13488818-A-T 11333142-A-T *
13488812-A-G 11333136-A-G *
13487982-G-A 11332306-G-A *
13487978-C-A 11332302-C-A *
13485358-G-C 11329682-G-C *
23793841-T-C 21631955-T-C Y*
13485327-T-G 11329651-T-G *
13484958-G-A 11329282-G-A *
13484668-T-G 11328992-T-G *
13480142-A-G 11324466-A-G *
13479363-A-G 11323687-A-G *
13479340-T-G 11323664-T-G *
13479332-T-C 11323656-T-C BY86029 *
13476573-G-A 11320897-G-A *
13472755-A-G 11317079-A-G *
13472752-C-A 11317076-C-A *
13748441-TGGAATGGAA-T 11592765-TGGAATGGAA-T *
23793842-G-A 21631956-G-A Y*
13472739-T-A 11317063-T-A *
13462399-G-C 11306723-G-C *
13472295-G-A 11316619-G-A *
13472271-C-CCT 11316595-C-CCT *
13472265-GAA-G 11316589-GAA-G *
13468491-A-G 11312815-A-G *
13468482-A-T 11312806-A-T *
13464478-A-C 11308802-A-C *
13462447-A-C 11306771-A-C *
13462420-C-A 11306744-C-A *
13462414-G-A 11306738-G-A *
13462401-C-T 11306725-C-T *
13448258-T-TCCA 11292582-T-TCCA *
28583682-G-C 26437535-G-C *
13263828-G-C 11108152-G-C *
13263826-G-T 11108150-G-T *
10626551-T-C *
9994853-TATAA-AATAA,T 10157244-TATAA-AATAA,T *
56830646-ACTCCT-A *
56764007-G-A *
56763715-T-G *
56678312-T-A *
56676514-A-C *
28815815-TG-T 26669668-TG-T *
10034365-G-GTT 10196756-G-GTT *
10034374-C-T 10196765-C-T Y*
13488067-T-TCC 11332391-T-TCC *
13482225-A-ACAAC 11326549-A-ACAAC *
13489874-T-A 11334198-T-A *
13489873-C-A 11334197-C-A *
13489865-G-C 11334189-G-C *
13489678-C-G 11334002-C-G *
13461970-C-T 11306294-C-T *
13461959-C-A 11306283-C-A *
13451206-C-CCATTG 11295530-C-CCATTG *
13451199-T-TTCCAC 11295523-T-TTCCAC *
13684841-G-C 11529165-G-C *
13482213-G-T 11326537-G-T *
13868763-GTGGAACAGAATTGAATGGAATAGAATCGAATGGATTGGAATTGATTGGAATAGACAGGAATGCAATGGACTTGAATGGAATTTACTGGAACAAAATGGAATCAAACGGATTGGAACTGAACGAAACAGAATGGAATGTAATGGAATGGCCTCGAATGGAATGGAGTTGAATGGAAGGGAATCGA-G 11748057-GTGGAACAGAATTGAATGGAATAGAATCGAATGGATTGGAATTGATTGGAATAGACAGGAATGCAATGGACTTGAATGGAATTTACTGGAACAAAATGGAATCAAACGGATTGGAACTGAACGAAACAGAATGGAATGTAATGGAATGGCCTCGAATGGAATGGAGTTGAATGGAAGGGAATCGA-G *
13481603-G-C 11325927-G-C *
13469128-C-A 11313452-C-A *
13463275-G-A 11307599-G-A *
13463269-C-T 11307593-C-T *
13269593-A-C 11113917-A-C *
9962561-CAG-C 10124952-CAG-C *
9951300-G-A 10113691-G-A FT373413 Y*
28814828-C-T 26668681-C-T *
13469332-C-T 11313656-C-T *
56838244-A-C *
13489929-G-C 11334253-G-C *
13478332-C-T 11322656-C-T *
56768618-G-A *
13447506-T-C 11291830-T-C *
13488064-CGG-C 11332388-CGG-C *
13481641-C-T 11325965-C-T *
13481583-T-G 11325907-T-G *
13480894-A-T 11325218-A-T *
13478741-C-T 11323065-C-T *
13469858-G-T 11314182-G-T *
5409140-T-G 5541099-T-G *
13447522-TA-T 11291846-TA-T *
13447518-CGA-C 11291842-CGA-C *
13447514-T-TG 11291838-T-TG *
13447504-C-T 11291828-C-T *
13465035-C-T 11309359-C-T *
13447474-GATTAC-G 11291798-GATTAC-G *
13423798-G-C 11268122-G-C *
13420149-TA-T 11264473-TA-T *
13347109-T-C 11191433-T-C *
13347101-A-ACT 11191425-A-ACT *
13723175-G-A 11567499-G-A *
13480995-C-G 11325319-C-G *
13480973-C-A 11325297-C-A *
13704866-C-G 11549190-C-G *
13701363-G-T 11545687-G-T *
56830805-C-CA *
56680375-A-G *
10034378-C-T 10196769-C-T Y*
13466337-T-C 11310661-T-C *
9965780-T-A 10128171-T-A Y*
9962693-C-G 10125084-C-G Y*
28812645-G-T 26666498-G-T *
13718063-C-T 11562387-C-T *
13697203-G-T 11541527-G-T *
13601698-G-A 11446022-G-A *
13480746-C-G 11325070-C-G *
13473742-C-T 11318066-C-T *
13473730-C-T 11318054-C-T *
9946276-G-C 10108667-G-C Y*
13247106-G-A 11091430-G-A *
56763992-CAATGG-C 9×AATGG*
56751872-G-A *
56734110-G-A *
13488844-G-GGGGCC 11333168-G-GGGGCC *
13481585-A-C 11325909-A-C *
13480164-G-C 11324488-G-C *
13480153-AT-A 11324477-AT-A *
13480147-T-C 11324471-T-C *
13478376-T-A 11322700-T-A *
13465551-G-C 11309875-G-C *
9965781-G-A 10128172-G-A Y*
13423697-T-G 11268021-T-G *
28587125-A-G 26440978-A-G *
13476723-C-T 11321047-C-T *
13489750-GCC-G 11334074-GCC-G *
13489749-C-CAA 11334073-C-CAA *
13489685-CCA-C 11334009-CCA-C *
13489624-C-T 11333948-C-T *
13488959-GCC-G 11333283-GCC-G *
13487892-G-C 11332216-G-C *
13480927-C-T 11325251-C-T *
13479476-T-A 11323800-T-A *
13479456-G-T 11323780-G-T *
13479451-G-T 11323775-G-T *
13476653-C-A 11320977-C-A *
13450083-AC-A 11294407-AC-A *
13474499-A-T 11318823-A-T *
13474495-A-C 11318819-A-C *
13474471-A-G 11318795-A-G *
13471557-TCA-T 11315881-TCA-T *
13470777-C-G 11315101-C-G *
13470513-C-A 11314837-C-A *
13470054-G-T 11314378-G-T *
13465312-T-A 11309636-T-A *
13465290-G-T 11309614-G-T *
13461942-C-A 11306266-C-A *
5009447-C-T 5141406-C-T *
9370426-C-G 9532817-C-G Y*
5761527-G-A 5893486-G-A *
13704504-G-C 11548828-G-C *
13707373-G-T 11551697-G-T *
13707038-G-A 11551362-G-A *
13707024-A-C 11551348-A-C *
13706597-G-A 11550921-G-A *
13704862-T-C 11549186-T-C *
13704855-T-G 11549179-T-G *
13704843-A-C 11549167-A-C *
13704765-A-G 11549089-A-G *
13704582-T-A 11548906-T-A *
13704142-A-T 11548466-A-T *
13709876-A-G 11554200-A-G *
13697412-GGAAAA-G 11541736-GGAAAA-G *
13697257-T-C 11541581-T-C *
13697038-T-A 11541362-T-A *
13694158-T-A 11538482-T-A *
13693254-T-A 11537578-T-A BY41203 *
13692258-C-T 11536582-C-T *
13692234-G-A 11536558-G-A *
13691798-T-TATGGAATGGAATGGAATGGAATGGAATGGA,TGGA 11536122-T-TATGGAATGGAATGGAATGGAATGGAATGGA,TGGA *
13690618-A-T 11534942-A-T *
13709817-A-G 11554141-A-G *
13709909-G-A 11554233-G-A *
13689371-G-GT 11533695-G-GT *
13721210-T-C 11565534-T-C *
14543102-G-A 12431303-G-A YY*
14259042-G-A 12138336-G-A Y*
13924854-C-A 11804148-C-A Y*
13838521-G-T 11717815-G-T *
13838507-G-GCATGTAACAGAATCGAACAA 11717801-G-GCATGTAACAGAATCGAACAA *
13816663-G-A 11695957-G-A *
13722707-G-T 11567031-G-T *
13722222-T-C 11566546-T-C *
13721227-T-A 11565551-T-A *
13721202-G-T 11565526-G-T *
13712021-G-T 11556345-G-T *
13721201-G-T 11565525-G-T *
13721126-C-T 11565450-C-T *
13721109-A-T 11565433-A-T *
13721012-G-A 11565336-G-A *
13718972-A-C 11563296-A-C *
13717121-G-T 11561445-G-T *
13713273-A-G 11557597-A-G *
13713262-T-C 11557586-T-C *
13713208-C-G 11557532-C-G *
13712032-C-G 11556356-C-G *
13689377-A-T 11533701-A-T *
13689370-C-T 11533694-C-T *
15324538-G-GC 13212656-G-GC *
13489017-C-CA 11333341-C-CA *
11334010-C- *
13489641-C-CAGCT 11333965-C-CAGCT *
11333955-A- *
11333953-C- *
11333942-CA- *
13489456-C-A 11333780-C-A *
13489448-A-G 11333772-A-G *
11333715-CCT- *
11333541-C- *
13489015-C-CA 11333339-C-CA *
11334089-TACC- *
13489010-CCA-C 11333334-CCA-C *
11333285-CCA- *
11333039-C- *
13488709-T-A 11333033-T-A *
13488708-G-GA 11333032-G-GA *
13488707-C-CA 11333031-C-CA *
11333001-C- *
13488370-G-C 11332694-G-C *
13488332-TC-T 11332656-TC-T *
13488329-TAC-T 11332653-TAC-T *
11334027-GCA- *
13489781-GC-G 11334105-GC-G *
13689366-GA-G 11533690-GA-G *
13583534-G-A 11427858-G-A *
13689035-T-G 11533359-T-G *
13688947-A-T 11533271-A-T *
13688237-C-CATGGCATGGAACGTGATGG,G 11532561-C-CATGGCATGGAACGTGATGG,G *
13688181-A-AGAATG,AGAATGGAATGGAATG 11532505-A-AGAATG,AGAATGGAATGGAATG 8×GAATG*
13684848-A-G 11529172-A-G *
13684840-T-TCAAATTAACC 11529164-T-TCAAATTAACC *
13666731-G-A 11511055-G-A *
13641219-A-T 11485543-A-T *
13597831-G-A 11442155-G-A *
13538381-T-C 11382705-T-C *
13489800-T-C 11334124-T-C *
13538371-G-A 11382695-G-A *
13534887-C-A 11379211-C-A *
13531207-A-T 11375531-A-T *
13531203-T-C 11375527-T-C *
13504421-G-T 11348745-G-T *
13499059-G-A 11343383-G-A *
13494556-T-TATATGTATATATATATATATATATA 11338880-T-TATATGTATATATATATATATATATA *
13494555-A-ATATATGTATATATATATATATATAT 11338879-A-ATATATGTATATATATATATATATAT 13×T*
13489947-G-A 11334271-G-A *
13489877-T-A 11334201-T-A *
14964114-C-T 12852189-C-T Y*
16642970-G-GAAATAATATATAGTAAAATCCATATACATCTATAATAAATAT 14531090-G-GAAATAATATATAGTAAAATCCATATACATCTATAATAAATAT *
13488323-C-G 11332647-C-G *
28810988-G-A 26664841-G-A *
56703130-G-A *
56699602-A-G *
28814875-A-G 26668728-A-G *
28814814-G-A 26668667-G-A *
28814779-A-G 26668632-A-G *
28813651-A-G 26667504-A-G *
28812930-T-G 26666783-T-G *
28812846-G-A 26666699-G-A *
28812691-T-A 26666544-T-A *
28810986-A-G 26664839-A-G *
56715199-A-T *
28810284-G-A 26664137-G-A *
28807834-G-C 26661687-G-C *
28805607-GGAATGGAGTGGAGTAGAATGGAATTTAATGGAGTGGAGTGGAATT-G 26659460-GGAATGGAGTGGAGTAGAATGGAATTTAATGGAGTGGAGTGGAATT-G *
28797324-G-A 26651177-G-A *
28795575-A-T 26649428-A-T *
28794289-A-C 26648142-A-C *
28793206-G-T 26647059-G-T *
28793205-G-T 26647058-G-T *
28718695-C-T 26572548-C-T *
28585443-G-A 26439296-G-A *
56707629-G-C *
56731955-CAATGGAATGG- 10×AATGG*
28583687-T-C 26437540-T-C *
56832357-C-CCACTCCTTTCCATTCCACTCCTTTCCACTCCACTCCCCTCCAA,CTCCCCTCCAA *
14470-A-G *
14434-C-T *
56876570-C-T *
56856800-G-C *
56836864-A-AATTCCATTACATTCCATTCC *
56834608-C-CACTTT *
56834398-C-CACT *
56834385-T-TTCCACTCCACTCCTGTCCAC *
56832529-CTCCAG-C *
56828925-ATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTCCATTCCATTCCCTTCGAATCCATTCCATTCCATTCCGTTTCC- *
56733282-C-T *
56828742-TCCA- *
56828006-TTCCGTTC-T *
56828002-TCCA-T *
56827998-C-A *
56827981-TTCCTTTCAAG-T *
56770671-T-G *
56756598-C-G *
56745319-G-T *
56742429-A-C *
56734481-G-GAATGCAATCGAATGC *
28583689-G-A 26437542-G-A *
28520545-G-A 26374398-G-A Y*
16648334-A-G 14536454-A-G YY*
22269422-A-G 20107536-A-G DYZ19 *
22448514-G-A 20286628-G-A DYZ19 *
22448509-G-T 20286623-G-T DYZ19 *
22359701-A-G 20197815-A-G DYZ19 *
22295453-T-TGG 20133567-T-TGG DYZ19 *
22295450-AC-A 20133564-AC-A DYZ19 *
22295447-T-C 20133561-T-C DYZ19 *
22295444-AC-A 20133558-AC-A DYZ19 *
22289321-C-A,G 20127435-C-A,G DYZ19 *
22275528-C-T 20113642-C-T DYZ19 *
22255775-A-G 20093889-A-G DYZ19 *
22448571-G-A 20286685-G-A DYZ19 *
21615535-G-A 19453649-G-A YY*
21615529-G-A 19453643-G-A YY*
19390799-G-A 17278919-G-A Y*
18415983-G-A 16304103-G-A P6_Gap *
18415976-G-A 16304096-G-A P6_Gap *
18050093-T-TATGTGTGTGTA 15938213-T-TATGTGTGTGTA *
18050092-T-TA 15938212-T-TA *
18050087-T-TACATA 15938207-T-TACATA *
17199423-T-G 15087543-T-G YY*
16757801-G-A 14645921-G-A YY*
22448539-G-A 20286653-G-A DYZ19 *
22449137-A-T 20287251-A-T DYZ19 *
28496982-C-T 26350835-C-T Y*
22511465-TTG-T 20349579-TTG-T DYZ19 *
27319137-C-T 25172990-C-T P1_g3 *
26325769-C-G 24179622-C-G P1_Y1 *
23414777-AC-A 21252891-AC-A *
23387825-G-A 21225939-G-A YY*
23352001-C-T 21190115-C-T YY*
22735007-A-T 20573121-A-T YY*
22635258-G-A 20473372-G-A Y*
22511485-A-G 20349599-A-G DYZ19 *
22511471-T-TCC 20349585-T-TCC DYZ19 *
22511422-T-A 20349536-T-A DYZ19 *
22449140-T-C 20287254-T-C DYZ19 *
22511397-A-C 20349511-A-C DYZ19 *
22510897-A-C 20349011-A-C DYZ19 *
22509968-T-C 20348082-T-C DYZ19 *
22509958-C-G 20348072-C-G DYZ19 *
22509949-G-T 20348063-G-T DYZ19 *
22449206-C-T 20287320-C-T DYZ19 *
22449195-G-T 20287309-G-T DYZ19 *
22449184-G-A 20287298-G-A DYZ19 *
22449148-T-C 20287262-T-C DYZ19 *
22449147-T-A 20287261-T-A DYZ19 *
13488325-G-T 11332649-G-T *
13488080-T-G 11332404-T-G *
5883254-C-T 6015213-C-T *
13447488-CCA-C 11291812-CCA-C *
13461700-A-T 11306024-A-T *
13461280-A-T 11305604-A-T *
13451682-T-TCCAA 11296006-T-TCCAA *
13451191-T-TC,TCCATTCCATTCCACTCCAGTTCATTC 11295515-T-TC,TCCATTCCATTCCACTCCAGTTCATTC *
13450181-GCA-CCA,G 11294505-GCA-CCA,G *
11294499-TCCATTGCATTCCATTCC- *
13450172-CACTCCATT-C 11294496-CACTCCATT-C *
13448664-C-T 11292988-C-T *
13447491-TGGC-T 11291815-TGGC-T *
13420173-C-T 11264497-C-T *
13461949-C-G 11306273-C-G *
13420172-G-T 11264496-G-T *
13420120-T-A 11264444-T-A *
13412898-A-T 11257222-A-T *
13403750-C-T 11248074-C-T *
13335775-T-C 11180099-T-C *
13279433-A-G 11123757-A-G *
13270406-C-A 11114730-C-A *
13269357-C-A 11113681-C-A *
13262202-A-C 11106526-A-C *
13257052-C-A 11101376-C-A *
13461708-GCT-G 11306032-GCT-G *
13463180-C-CTT 11307504-C-CTT *
13247121-AGTCCCTAGGTAACTAAAAGGCCCCAAGTGGACATGAT-A 11091445-AGTCCCTAGGTAACTAAAAGGCCCCAAGTGGACATGAT-A *
13464749-TG-T 11309073-TG-T *
13467325-C-A 11311649-C-A *
13466956-G-GTAAAGCCTAGACAACTTTTAGATCACCT 11311280-G-GTAAAGCCTAGACAACTTTTAGATCACCT *
13466839-A-T 11311163-A-T *
13466795-G-C 11311119-G-C *
13465577-A-T 11309901-A-T *
13465555-T-A 11309879-T-A *
13465341-CTTGGTTGATCAG-C 11309665-CTTGGTTGATCAG-C *
13465315-G-A 11309639-G-A *
13465292-G-T 11309616-G-T *
13464739-T-G 11309063-T-G *
13463966-G-T 11308290-G-T *
13464729-C-T 11309053-C-T *
13464722-A-G 11309046-A-G *
13464704-A-T 11309028-A-T *
13464691-C-A 11309015-C-A *
13464068-G-C 11308392-G-C *
13464054-C-T 11308378-C-T *
13464021-A-C 11308345-A-C *
13464015-C-T 11308339-C-T *
13464008-T-A 11308332-T-A *
13463986-T-A 11308310-T-A *
13252784-T-G 11097108-T-G *
11014499-CTCTATTCCATTCCAT-C *
13467410-G-C 11311734-G-C *
9370537-G-A 9532928-G-A Y*
9990357-A-C 10152748-A-C Y*
9990348-T-C 10152739-T-C Y*
9965799-T-G 10128190-T-G Y*
9965794-T-A 10128185-T-A Y*
9964097-T-A 10126488-T-A Y*
9945493-T-A 10107884-T-A Y*
9932296-G-A 10094687-G-A Y*
9924486-A-ACT 10086877-A-ACT *
9924480-TTC-T 10086871-TTC-T *
9370445-C-T 9532836-C-T Y*
9992868-GC-G 10155259-GC-G *
13472344-C-CATGTG 11316668-C-CATGTG *
9221660-CATATATAT-C,CATAT 9384051-CATATATAT-C,CATAT 27×AT*
7783282-T-A 7915241-T-A YY*
7448386-G-A 7580345-G-A IR1_L *
7107013-A-C,C 7238972-A-C,C *
6641356-C-A 6773315-C-A Y*
6403222-G-A 6535181-G-A *
6403205-T-G 6535164-T-G *
6403201-G-A 6535160-G-A *
6012387-C-T 6144346-C-T *
9992606-C-T 10154997-C-T Y*
10022071-G-A 10184462-G-A Y*
10861902-T-C *
10826960-G-A *
10861895-A-T *
10861886-A-T *
10861877-C-G *
10861872-C-G *
10829758-A-T *
10829752-CAT-C *
10829748-ATGG-A *
10826988-C-T *
10826971-T-C *
10818717-A-AGT *
10041799-T-TTTGA 10204190-T-TTTGA *
10818709-TCCCTTC-T *
10799562-T-TTCCACTCCTTTCCACTCCATTCCATTCCACTCCACTCCAC *
10794440-G-A *
10766960-A-G *
10765801-CTCTAT-C *
10765694-C-T *
10673944-ACCCCATTCCATTCCATTCCATTCCATTG- *
10632823-ATTCCATTCCTTTTCTTCGACAGGATCTCGCTCTGTCACTCAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACATTTCATTTCACCATTCCATTTTATTCCATTGCATTCCATACC-A,A *
10093644-TTTC-T 10256035-TTTC-T *
10093641-G-GGGT 10256032-G-GGGT *
13467330-G-C 11311654-G-C *
13467564-C-T 11311888-C-T *
13488079-G-A 11332403-G-A *
13478386-G-A 11322710-G-A *
13479437-T-A 11323761-T-A *
13479434-G-C 11323758-G-C *
13479411-C-A 11323735-C-A *
13479406-A-T 11323730-A-T *
13478713-G-A 11323037-G-A *
13478711-C-A 11323035-C-A *
13478708-TC-T 11323032-TC-T *
13478694-G-C 11323018-G-C *
13478460-C-A 11322784-C-A *
13478381-A-C 11322705-A-C *
13480701-GC-G 11325025-GC-G *
13478352-T-C 11322676-T-C *
13478346-G-A 11322670-G-A *
13478339-G-T 11322663-G-T *
13478271-G-A 11322595-G-A *
13478249-A-AAT 11322573-A-AAT *
13478160-G-A 11322484-G-A *
11322458-T- *
13478128-C-CTT 11322452-C-CTT *
13478091-T-G 11322415-T-G *
13478090-C-T 11322414-C-T *
13480232-A-T 11324556-A-T *
13480955-G-A 11325279-G-A *
11320734-C- *
13486372-C-G 11330696-C-G *
13488041-C-T 11332365-C-T *
13488027-GGACA-G 11332351-GGACA-G *
13488026-C-CTAT 11332350-C-CTAT *
13488020-C-A 11332344-C-A *
13487929-C-A 11332253-C-A *
13487813-C-G 11332137-C-G *
13487554-T-C 11331878-T-C *
13487535-G-A 11331859-G-A *
13487459-T-A 11331783-T-A *
13485692-TAA-T 11330016-TAA-T *
13481048-T-A 11325372-T-A *
13484936-AT-A 11329260-AT-A *
13484881-C-G 11329205-C-G *
13484845-G-T 11329169-G-T *
11328566-A- *
13483753-G-C 11328077-G-C *
13483736-C-T 11328060-C-T *
13481787-TGTCACAATGTCCCCTGTAGGCAGAACATAGAGAAGAGTTGCATCACCTGGGTGATCAGTGCAGAGATAG-T 11326111-TGTCACAATGTCCCCTGTAGGCAGAACATAGAGAAGAGTTGCATCACCTGGGTGATCAGTGCAGAGATAG-T *
13481079-A-AAT 11325403-A-AAT *
13481076-ACC-A 11325400-ACC-A *
13481071-A-ATAACAC 11325395-A-ATAACAC *
11321185-GCT- *
11320729-G- *
13467605-T-A 11311929-T-A *
11314214-C- *
13476245-A-ATGCT 11320569-A-ATGCT *
13475520-G-C 11319844-G-C *
13475308-C-T 11319632-C-T FT390130 *
11318788-A- *
13472176-C-A 11316500-C-A *
13471536-C-T 11315860-C-T *
13470785-C-T 11315109-C-T *
13470026-A-G 11314350-A-G *
13469937-C-CAT 11314261-C-CAT *
13469855-G-GTGGAAGACTGGCATTGTGCCTTCGCTCTCCTTGCCAGTTTCCAAAACTGCCACACCGAAGACTCCCCATGTTGCCGCACAC 11314179-G-GTGGAAGACTGGCATTGTGCCTTCGCTCTCCTTGCCAGTTTCCAAAACTGCCACACCGAAGACTCCCCATGTTGCCGCACAC *
13476252-C-T 11320576-C-T *
11314054-C- *
11314045-GCAGAGATACGTCACAAAGCCCCGTAGGCAGAGCATAGACAAGAT- *
13469712-GTAATCAGTGCAGAGATACGTCA-G 11314036-GTAATCAGTGCAGAGATACGTCA-G *
13469651-G-C 11313975-G-C *
13469197-C-A 11313521-C-A *
13469163-C-A 11313487-C-A *
13468374-A-G 11312698-A-G *
13468360-T-C 11312684-T-C *
13467654-G-T 11311978-G-T *
13467638-G-A 11311962-G-A *
13476248-A-C 11320572-A-C *
13476253-CCCATAG-C 11320577-CCCATAG-C *
13476403-TAGACAACTGTTACA-T 11320727-TAGACAACTGTTACA-T *
13476351-TCA-T 11320675-TCA-T *
13476399-A-T 11320723-A-T *
13476397-A-ATG 11320721-A-ATG *
13476391-GTAA-G 11320715-GTAA-G *
13476389-CT-C 11320713-CT-C *
13476371-GAGATATGTCACA-G 11320695-GAGATATGTCACA-G *
13476362-ATC-A 11320686-ATC-A *
13476359-GT-G 11320683-GT-G *
13476357-G-A 11320681-G-A *
13476354-GC-G 11320678-GC-G *
13476342-AAAGTCC-A 11320666-AAAGTCC-A *
13476261-CAGA-C 11320585-CAGA-C *
13476340-AT-A 11320664-AT-A *
13476330-AGAG-A 11320654-AGAG-A *
13476319-CCCCCAT-C 11320643-CCCCCAT-C *
13476312-CACAA-C 11320636-CACAA-C *
13476310-G-C 11320634-G-C *
11320627-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA- *
13476297-GGTGTAGAGATAT-G 11320621-GGTGTAGAGATAT-G *
13476290-GGTGAT-G 11320614-GGTGAT-G *
13476287-CT-C 11320611-CT-C *
13476266-CTAACACAAGAGTTACATCA-C 11320590-CTAACACAAGAGTTACATCA-C *
13472744-G-T 11317068-G-T *
13469892-A-C 11314216-A-C *
13472338-G-GAAACCCCTCCGGTGGCT 11316662-G-GAAACCCCTCCGGTGGCT *
28794160-G-C 26648013-G-C *
13468271-G-T 11312595-G-T *
9990546-CCTT-C 10152937-CCTT-C *
13483954-G-A 11328278-G-A *
13465205-C-A 11309529-C-A *
10093592-A-G 10255983-A-G *
58887407-C-A 56703464-G-T *
22289312-T-A 20127426-T-A DYZ19 *
58866062-C-A 56724809-G-T *
28794161-T-G 26648014-T-G *
13701650-A-T 11545974-A-T *
10081627-T-A 10244018-T-A *
13726335-G-A 11570659-G-A *
13489060-G-T 11333384-G-T *
59030570-T-TAATATA 56884423-T-TAATATA *
13704115-T-TATGGA 11548439-T-TATGGA *
13287971-C-CTCTCTCTA 11132295-C-CTCTCTCTA *
13520266-G-A 11364590-G-A FGC26056 *
13356015-T-A 11200339-T-A FGC26024 *
58893731-T-C 56697140-A-G *
58858916-GCATTC-G 56731940-CAATGG-C *
13868601-G-T 11747895-G-T *
10081624-A-C 10244015-A-C *
10081631-G-A 10244022-G-A FT427374 *
22490451-G-T 20328565-G-T BY196892 DYZ19 *
10093200-T-TGTC 10255591-T-TGTC *
13480886-G-T 11325210-G-T *
10988666-A-G *
10988659-C-A *
56879950-T-G *
9990418-G-C 10152809-G-C Y*
10775677-G-T *
10093211-G-C 10255602-G-C *
10093207-T-A 10255598-T-A *
10093206-T-G 10255597-T-G *
10093190-AAAAGAT-A 10255581-AAAAGAT-A *
10081633-C-G 10244024-C-G *
10093185-A-ATAT 10255576-A-ATAT *
10093163-C-A 10255554-C-A *
10093160-G-T 10255551-G-T *
10093159-C-G 10255550-C-G *
10093143-G-T 10255534-G-T FT427471 *
14073148-C-A 11952442-C-A YY*
28814886-G-C 26668739-G-C *
13462168-C-G 11306492-C-G *
13462368-G-A 11306692-G-A *
10081635-A-G 10244026-A-G *
13487874-C-A 11332198-C-A *
13478054-G-A 11322378-G-A *
10765704-AATTAC-A *
9198800-G-T 9361191-G-T Y*
58844926-C-G 56745945-G-C *
13529798-A-T 11374122-A-T *
22510737-C-T 20348851-C-T BY225677 DYZ19 *
13518489-A-C 11362813-A-C *
13518488-G-T 11362812-G-T *
13483901-A-T 11328225-A-T *
13489167-T-A 11333491-T-A *
58843100-G-C 56747771-C-G *
13465130-A-C 11309454-A-C A18082 FT36991 *
13446099-A-T 11290423-A-T *
13480120-C-T 11324444-C-T *
13487970-G-A 11332294-G-A *
58846558-T-A 56744313-A-T *
22508740-T-A 20346854-T-A DYZ19 *
22283931-A-C 20122045-A-C FGC81086 DYZ19 *
13469764-A-T 11314088-A-T *
13718214-T-C 11562538-T-C *
13712047-T-C 11556371-T-C *
22635311-G-A 20473425-G-A Y*
22635304-T-C 20473418-T-C Y*
22635296-T-C 20473410-T-C Y*
13489730-T-G 11334054-T-G *
58869007-C-T 56721864-G-A *
13480133-A-T 11324457-A-T *
13484886-C-G 11329210-C-G *
22506344-A-T 20344458-A-T DYZ19 *
22239693-G-A 20077807-G-A DYZ19 *
13695726-A-C 11540050-A-C BY88926 *
58865682-C-G 56725189-G-C *
13465213-T-C 11309537-T-C *
58844521-C-T 56746350-G-A *
13489162-C-A 11333486-C-A *
13465219-C-T 11309543-C-T *
13484890-T-C 11329214-T-C *
58887477-C-T 56703394-G-A *
58858810-T-C 56732061-A-G *
13347750-A-C 11192074-A-C *
58844833-T-C 56746038-A-G *
22510702-T-A 20348816-T-A DYZ19 *
22510699-G-C 20348813-G-C DYZ19 *
22510692-C-G 20348806-C-G DYZ19 *
22449198-G-C 20287312-G-C DYZ19 *
58884468-A-G 56706403-T-C *
13697233-G-A 11541557-G-A *
22509342-G-T 20347456-G-T DYZ19 *
58843067-T-C 56747804-A-G *
13712611-A-G 11556935-A-G *
13468458-C-A 11312782-C-A *
13465743-T-G 11310067-T-G BY85729 *
28812463-G-C 26666316-G-C *
13488134-A-T 11332458-A-T *
13487975-C-T 11332299-C-T *
13463767-G-A 11308091-G-A *
13462195-A-T 11306519-A-T *
13489823-T-G 11334147-T-G *
13476458-T-G 11320782-T-G *
13475501-C-T 11319825-C-T *
9992756-C-T 10155147-C-T Y*
13487516-G-C 11331840-G-C *
13460946-G-C 11305270-G-C *
13480185-C-A 11324509-C-A *
10826958-C-A *
11007828-C-A *
13705548-A-T 11549872-A-T *
13484634-C-A 11328958-C-A *
13485666-G-A 11329990-G-A *
13480929-A-T 11325253-A-T *
13712613-G-A 11556937-G-A *
16648330-C-T 14536450-C-T YY*
10081659-G-T 10244050-G-T *
10081658-G-A 10244049-G-A FT427376 *
13480230-G-A 11324554-G-A *
9936433-G-A 10098824-G-A Y*
10081655-G-T 10244046-G-T *
13465178-G-A 11309502-G-A *
13690065-G-A 11534389-G-A *
13465100-G-C 11309424-G-C FT444001 *
13465073-G-A 11309397-G-A *
13489783-C-A 11334107-C-A *
56855530-C-A *
10861907-T-C *
22510127-G-A 20348241-G-A FT460741 DYZ19 *
28805917-G-A 26659770-G-A *
22511229-G-C 20349343-G-C DYZ19 *
9997147-A-T 10159538-A-T Y*
56830628-A-C *
13475488-A-T 11319812-A-T *
13711568-G-A 11555892-G-A *
58857613-A-G 56733258-T-C *
13712988-C-T 11557312-C-T FT449439 *
13480137-C-T 11324461-C-T *
13474480-C-A 11318804-C-A *
9931339-T-A 10093730-T-A Y*
3456714-C-A 3588673-C-A *
3456712-A-G 3588671-A-G *
13484928-A-T 11329252-A-T *
10081656-A-G 10244047-A-G *
13488588-C-A 11332912-C-A *
13474457-T-G 11318781-T-G *
13712260-A-G 11556584-A-G *
13489595-C-A 11333919-C-A *
13488112-G-T 11332436-G-T *
13470436-C-T 11314760-C-T *
56835066-C-CTCCACTCCGT *
9990400-T-C 10152791-T-C Y*
13489633-CCA-C 11333957-CCA-C *
13474485-G-C 11318809-G-C *
11007825-T-A *
10911141-T-C *
13257475-T-C 11101799-T-C *
13487855-C-A 11332179-C-A *
13257472-G-A 11101796-G-A *
10851108-G-A *
10851086-A-G *
10851084-C-G *
13484866-C-A 11329190-C-A *
13487927-G-T 11332251-G-T *
56829955-C-CTCTAT *
56829942-C-CAATTG *
13489914-C-A 11334238-C-A *
13487739-T-TAG 11332063-T-TAG *
13690567-T-C 11534891-T-C *
13488984-A-G 11333308-A-G *
13477105-T-G 11321429-T-G *
13475502-C-T 11319826-C-T *
9990402-T-G 10152793-T-G Y*
9990395-A-T 10152786-A-T Y8×T*
9990383-A-C 10152774-A-C Y*
10973628-G-T *
10959023-T-A *
56836115-C-CCACCT *
13489106-C-A 11333430-C-A *
10034337-C-A 10196728-C-A Y*
10826959-T-A *
28814891-G-T 26668744-G-T *
10829714-C-A *
13539059-G-A 11383383-G-A *
13461123-T-G 11305447-T-G *
13487736-C-T 11332060-C-T *
10807359-C-G *
5829010-C-T 5960969-C-T *
13473745-G-A 11318069-G-A *
13462217-A-G 11306541-A-G *
13475506-G-T 11319830-G-T *
13462338-C-A 11306662-C-A *
13487917-G-T 11332241-G-T BY86190 *
13539063-T-G 11383387-T-G *
13137086-T-C 10626572-T-C *
13515666-C-A 11359990-C-A *
13690564-G-T 11534888-G-T FT448609 *
3570900-G-A 3702859-G-A *
5357514-A-T 5489473-A-T *
5357501-T-A 5489460-T-A *
5357484-G-C 5489443-G-C *
4554832-C-G 4686791-C-G *
4554737-C-T 4686696-C-T FTA42700 *
4548036-A-G 4679995-A-G *
4512176-A-G 4644135-A-G *
4431604-A-T 4563563-A-T *
3577098-T-TGACAG 3709057-T-TGACAG *
13622662-C-T 11466986-C-T *
5667808-T-C 5799767-T-C *
13622661-A-G 11466985-A-G *
13255722-A-G 11100046-A-G *
13511605-C-A 11355929-C-A *
13531157-A-T 11375481-A-T *
10022421-T-G 10184812-T-G Y*
13434851-T-G 11279175-T-G *
58839001-A-T 56751870-T-A *
13488286-G-T 11332610-G-T *
13488279-G-T 11332603-G-T *
13488259-T-C 11332583-T-C *
5662405-C-T 5794364-C-T *
6006838-G-T 6138797-G-T *
10093581-T-C 10255972-T-C *
13473868-G-C 11318192-G-C *
13509983-A-G 11354307-A-G *
13509965-G-A 11354289-G-A *
13509957-G-A 11354281-G-A *
13500732-T-G 11345056-T-G *
13500729-A-G 11345053-A-G *
13499210-A-G 11343534-A-G *
13495116-T-G 11339440-T-G *
13495092-A-G 11339416-A-G *
13495077-T-C 11339401-T-C *
13449351-C-CCTAAA 11293675-C-CCTAAA *
6006845-C-T 6138804-C-T *
13423122-G-T 11267446-G-T *
13407110-C-G 11251434-C-G *
13399966-T-C 11244290-T-C *
13356003-A-T 11200327-A-T *
13355984-C-A 11200308-C-A *
13259580-G-A 11103904-G-A *
13252781-CA-C 11097105-CA-C *
10093217-G-T 10255608-G-T *
10041584-A-C 10203975-A-C *
9944533-T-G 10106924-T-G Y*
10093672-C-T 10256063-C-T *
13634695-T-C 11479019-T-C *
13520279-A-C 11364603-A-C *
10025203-C-T 10187594-C-T Y*
22448532-C-G 20286646-C-G DYZ19 *
22511409-A-C 20349523-A-C DYZ19 *
13461998-C-T 11306322-C-T *
13137007-A-C 10626493-A-C *
13137003-A-C 10626489-A-C *
13723409-A-G 11567733-A-G *
13523946-G-A 11368270-G-A *
6402061-C-A 6534020-C-A *
28811928-G-T 26665781-G-T *
58840984-A-C 56749887-T-G *
58862115-A-T 56728756-T-A *
58974165-T-C 56828018-T-C *
22295425-AGAAT-A 20133539-AGAAT-A DYZ19 *
13487543-T-C 11331867-T-C *
13489638-A-C 11333962-A-C *
13489620-C-T 11333944-C-T *
13472278-C-T 11316602-C-T FT444084 *
13447544-C-T 11291868-C-T *
13695656-G-C 11539980-G-C *
13469707-G-C 11314031-G-C *
22428623-C-T 20266737-C-T DYZ19 *
18050095-C-A 15938215-C-A YY*
13465747-T-C 11310071-T-C *
58893401-A-G 56697470-T-C *
13253750-C-G 11098074-C-G *
58866272-G-C 56724599-C-G *
58830984-A-T 56759887-T-A *
58869578-C-T 56721293-G-A *
13489729-C-T 11334053-C-T *
9992860-C-A 10155251-C-A Y*
13478758-C-T 11323082-C-T *
13509288-C-T 11353612-C-T *
13256015-C-T 11100339-C-T *
9931259-G-A 10093650-G-A Y*
13307007-T-C 11151331-T-C *
13510281-T-C 11354605-T-C *
13485439-G-T 11329763-G-T *
13136965-T-C 10626451-T-C *
58982301-T-C 56836154-T-C *
9959660-CAG-C 10122051-CAG-C *
13472300-A-G 11316624-A-G S14074 *
13253753-C-G 11098077-C-G *
13277616-C-T 11121940-C-T *
13253708-A-T 11098032-A-T *
58874684-A-C 56716187-T-G *
58874683-A-C 56716188-T-G *
13488312-C-A 11332636-C-A *
13518490-G-C 11362814-G-C FGC281 Y133723 *
13529783-TAAAAAA-T 11374107-TAAAAAA-T 16×A*
58869676-C-A 56721195-G-T *
59026512-C-T 56880365-C-T *
13423684-TTTA-T 11268008-TTTA-T *
58869801-C-G 56721070-G-C *
58880442-T-G 56710429-A-C *
9994930-G-A 10157321-G-A Y*
6402056-G-T 6534015-G-T *
13505048-GA-G 11349372-GA-G *
9977946-C-G 10140337-C-G Y*
59031043-C-A 56884896-C-A *
59029429-G-A 56883282-G-A *
59019880-G-A 56873733-G-A *
13711744-GAATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA-G 11556068-GAATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA-G *
59015381-T-C 56869234-T-C *
59013026-A-T 56866879-A-T *
59009057-C-T 56862910-C-T *
59008525-G-A 56862378-G-A *
59007723-C-G 56861576-C-G *
58971508-A-G 56825361-A-G *
58970507-T-A 56824360-T-A *
58969898-G-A 56823751-G-A *
28805206-G-T 26659059-G-T *
28585326-C-G 26439179-C-G Z25212 *
59033423-T-C 56887276-T-C *
58898119-T-C 56692752-A-G FGCLR390 *
13706568-G-A 11550892-G-A FT268475 *
13489044-G-A 11333368-G-A *
58891476-C-A 56699395-G-T *
58891353-T-A 56699518-A-T *
13480123-C-T 11324447-C-T *
59013638-ATTT-A 56867491-ATTT-A 11×T*
58891018-T-A 56699853-A-T *
58836270-T-A 56754601-A-T *
58836204-T-A 56754667-A-T *
58836198-G-A 56754673-C-T *
58836197-C-A 56754674-G-T *
13489016-C-T 11333340-C-T *
13479063-C-T 11323387-C-T *
13488979-C-T 11333303-C-T *
13488827-G-T 11333151-G-T *
13136953-T-G 10626439-T-G *
13136902-T-A 10626388-T-A *
13478133-ATC-A 11322457-ATC-A *
58898313-C-T 56692558-G-A *
13472741-G-A 11317065-G-A *
22510674-G-A 20348788-G-A BY225669 DYZ19 *
22490468-TG-T 20328582-TG-T DYZ19 *
28807375-G-A 26661228-G-A *
13717881-A-C 11562205-A-C *
13691024-A-C 11535348-A-C *
13538367-A-G 11382691-A-G *
18687515-T-G 16575635-T-G YY*
13404412-A-G 11248736-A-G *
13473221-A-G 11317545-A-G *
13484463-C-T 11328787-C-T *
13489144-G-A 11333468-G-A *
13489003-C-T 11333327-C-T *
59021041-C-T 56874894-C-T *
28793456-G-C 26647309-G-C *
28586353-A-T 26440206-A-T PF1322 *
22289308-A-G 20127422-A-G DYZ19 *
16642608-C-T 14530728-C-T YY*
3249653-T-G 3381612-T-G *
13622681-G-T 11467005-G-T *
13622526-C-T 11466850-C-T *
13611684-C-A 11456008-C-A *
13611675-T-G 11455999-T-G *
13571109-A-C 11415433-A-C *
13571106-C-T 11415430-C-T *
13571094-AG-A 11415418-AG-A *
13570876-C-T 11415200-C-T *
13561548-G-A 11405872-G-A *
13538991-T-G 11383315-T-G *
3249647-A-G 3381606-A-G *
4548441-C-T 4680400-C-T FT320990 *
13622535-C-A 11466859-C-A *
13472076-A-T 11316400-A-T *
13562223-A-G 11406547-A-G *
13554754-A-G 11399078-A-G *
13550225-G-A 11394549-G-A *
13537686-A-C 11382010-A-C *
13537669-C-A 11381993-C-A *
13536672-A-G 11380996-A-G *
13534869-G-T 11379193-G-T *
13530059-T-G 11374383-T-G *
13530058-T-G 11374382-T-G *
13495327-T-C 11339651-T-C *
13470019-G-A 11314343-G-A *
4585401-A-G 4717360-A-G *
13449727-T-TAAACC 11294051-T-TAAACC *
13440166-G-T 11284490-G-T *
13429243-A-C 11273567-A-C *
13362741-C-T 11207065-C-T *
13306144-G-T 11150468-G-T *
13294654-C-G 11138978-C-G *
13267275-T-C 11111599-T-C *
9960918-C-T 10123309-C-T Y*
6402201-A-G 6534160-A-G *
4867763-C-T 4999722-C-T *
28814800-A-T 26668653-A-T *
13460853-C-T 11305177-C-T *
13472336-G-GAGCCTCCGCAGCATCCAGTCC 11316660-G-GAGCCTCCGCAGCATCCAGTCC *
9983987-A-T 10146378-A-T Y*
13531185-C-T 11375509-C-T *
13489922-T-G 11334246-T-G *
22510762-G-C 20348876-G-C DYZ19 *
22448577-C-T 20286691-C-T DYZ19 *
13562361-C-T 11406685-C-T *
13492646-C-T 11336970-C-T *
13601688-G-A 11446012-G-A FGC77286 *
13583552-T-C 11427876-T-C *
13479068-G-T 11323392-G-T *
56724397-T-C *
9924435-T-A 10086826-T-A Y*
22508763-G-A 20346877-G-A DYZ19 *
22508730-T-A 20346844-T-A DYZ19 *
22270448-A-G 20108562-A-G DYZ19 *
13470013-A-G 11314337-A-G *
13470005-A-C 11314329-A-C *
13476582-C-T 11320906-C-T *
13481651-T-C 11325975-T-C *
13481644-A-T 11325968-A-T *
13481638-C-A 11325962-C-A *
13481630-G-A 11325954-G-A *
13479435-G-A 11323759-G-A *
9924471-A-T 10086862-A-T Y*
56867482-T-TAA *
13476689-G-C 11321013-G-C *
13444623-G-A 11288947-G-A *
13377708-C-A 11222032-C-A *
10039748-TA-T 10202139-TA-T *
13469914-C-A 11314238-C-A *
13476370-A-G 11320694-A-G *
56861812-CAAAAAAAAA-C,CAAAAA 26×A*
13476574-T-A 11320898-T-A *
13488068-G-A 11332392-G-A *
13476709-G-T 11321033-G-T *
13461918-C-A 11306242-C-A *
9924476-C-T 10086867-C-T Y*
13470734-C-T 11315058-C-T *
56828923-TCATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTC-T 5×CATTC*
13536896-G-A 11381220-G-A *
13534839-T-A 11379163-T-A *
13529068-G-A 11373392-G-A *
13554952-T-C 11399276-T-C *
13530078-G-A 11374402-G-A *
9924462-C-T 10086853-C-T Y*
13473216-A-C 11317540-A-C *
9924510-A-T 10086901-A-T Y*
13481596-A-G 11325920-A-G *
13476240-A-G 11320564-A-G *
13494577-G-C 11338901-G-C *
10022407-T-C 10184798-T-C Y*
13347773-A-G 11192097-A-G *
13347695-C-T 11192019-C-T *
13247379-C-T 11091703-C-T *
11034309-C-G *
10082056-G-C 10244447-G-C *
10082046-G-A 10244437-G-A *
10082033-A-C 10244424-A-C *
10082019-C-A 10244410-C-A *
10082017-T-A 10244408-T-A *
10022398-T-C 10184789-T-C Y*
13538421-T-G 11382745-T-G *
9924496-T-C 10086887-T-C Y*
22510192-C-G 20348306-C-G DYZ19 *
13482338-A-G 11326662-A-G *
13480243-G-T 11324567-G-T *
13691906-G-A 11536230-G-A BY54349 *
22735006-A-T 20573120-A-T YY*
13538400-A-C 11382724-A-C *
13538393-A-G 11382717-A-G *
13500089-G-A 11344413-G-A *
13465229-T-C 11309553-T-C *
13347777-A-T 11192101-A-T *
13591385-T-C 11435709-T-C *
28795206-G-T 26649059-G-T *
13470566-A-C 11314890-A-C *
28795191-G-C 26649044-G-C *
28795149-C-G 26649002-C-G *
28795141-G-C 26648994-G-C *
13480231-T-C 11324555-T-C *
13475405-G-A 11319729-G-A *
13488098-G-A 11332422-G-A *
13488088-C-T 11332412-C-T *
13488062-G-A 11332386-G-A *
13712541-T-A 11556865-T-A *
13484951-G-A 11329275-G-A *
13713272-C-G 11557596-C-G *
13605913-C-T 11450237-C-T *
13464967-C-A 11309291-C-A *
13411548-C-T 11255872-C-T *
13411544-A-G 11255868-A-G *
13609180-C-T 11453504-C-T *
13511717-C-T 11356041-C-T *
13510304-G-A 11354628-G-A *
13443441-A-G 11287765-A-G *
56878253-G-GCA,GCACACA 9×CA*
13605982-A-G 11450306-A-G *
13605958-C-A 11450282-C-A *
13460635-G-T 11304959-G-T *
9992601-G-T 10154992-G-T Y*
10775678-C-T *
10081709-G-A 10244100-G-A *
10093336-T-A 10255727-T-A *
10093332-G-C 10255723-G-C *
10093329-G-T 10255720-G-T *
10093314-T-C 10255705-T-C *
10093312-C-G 10255703-C-G *
10093305-C-T 10255696-C-T *
10081718-T-G 10244109-T-G *
10081712-A-C 10244103-A-C FT427380 *
10081710-C-G 10244101-C-G *
10081692-A-C 10244083-A-C *
10626228-T-A *
10081685-T-C 10244076-T-C *
10081682-A-G 10244073-A-G *
9994910-GC-G 10157301-GC-G *
9959873-TAATAATAATA-T 10122264-TAATAATAATA-T *
9056674-G-GTA *
9056671-ACC-A *
9056626-A-AGTCTTCATATGTTGTGGATAACAGACTTCTTACATCTACAAC *
9056624-A-AC *
9056621-A-ACTATTTCTCCATTTTGTATTTCTATTGTCTTTTTTTTTTTCTTGAGTT *
9056619-T-TTTGTGTTC *
10093338-C-T 10255729-C-T *
10626230-T-C *
6012407-G-A 6144366-G-A *
13463730-A-T 11308054-A-T *
13472332-T-TCA 11316656-T-TCA *
13469932-GAC-G 11314256-GAC-G *
13469920-C-T 11314244-C-T *
13469905-G-C 11314229-G-C *
13469899-A-T 11314223-A-T *
13477153-T-A 11321477-T-A *
13469875-C-G 11314199-C-G *
13469863-A-T 11314187-A-T *
13465150-G-A 11309474-G-A *
13351944-A-T 11196268-A-T *
10626238-G-A *
10859893-C-CTCCAT *
10626484-G-A *
10626477-G-C *
10626410-T-G *
10626395-T-A *
10626392-G-A *
10626375-G-T *
10626363-T-C *
10626247-T-G *
10626245-G-C *
6012453-C-CA 6144412-C-CA *
6012402-T-C 6144361-T-C *
9992649-A-G 10155040-A-G Y*
13465561-T-A 11309885-T-A *
10632738-ATTCCATCCATATCATTCCATTCCC-A,A *
10632717-G-C,C *
10632714-CA-C,C *
10632709-A-C,C *
28811020-A-C 26664873-A-C *
28585419-G-A 26439272-G-A *
15639347-C-A 13527467-C-A Y*
13723165-A-C 11567489-A-C *
13723163-G-C 11567487-G-C *
13257440-C-T 11101764-C-T *
10632777-ACTCCTGTCCTCTTCT-A,A *
11010931-T-A *
9932087-TTAAAA-T 10094478-TTAAAA-T *
13471547-C-G 11315871-C-G *
13463708-G-A 11308032-G-A *
9997162-C-A 10159553-C-A Y*
9994912-C-T 10157303-C-T Y*
9994905-T-A 10157296-T-A Y*
9994902-G-A 10157293-G-A Y*
9992694-G-A 10155085-G-A Y*
9992655-A-G 10155046-A-G Y*
10632765-CAACTG-C,C *
10632799-TC-T,T *
6012400-G-C 6144359-G-C *
13482334-C-A 11326658-C-A *
26594-G-T *
26574-C-T *
26556-G-C *
26548-T-C *
26544-A-T *
56830803-T-TCCGC *
16642838-C-A 14530958-C-A YY*
16642835-AC-A 14530955-AC-A *
13729011-A-G 11573335-A-G *
13583731-T-G 11428055-T-G *
13479030-C-A 11323354-C-A *
10632802-ATTCCATTCCACTCCAT-A,A *
13477151-A-C 11321475-A-C *
13469912-T-C 11314236-T-C *
13468474-G-T 11312798-G-T *
13468464-C-T 11312788-C-T *
13463852-AGC-A 11308176-AGC-A *
13463849-AG-A 11308173-AG-A *
13463839-T-C 11308163-T-C *
13463835-CCG-C 11308159-CCG-C *
13463833-TA-T 11308157-TA-T *
13462426-G-T 11306750-G-T *
10859654-C-T *
13482547-C-CA 11326871-C-CA *
13460854-C-A 11305178-C-A *
13706149-G-T 11550473-G-T FT449165 *
13449042-GCA-G 11293366-GCA-G *
13267260-C-T 11111584-C-T *
13470477-G-T 11314801-G-T *
13478334-C-T 11322658-C-T *
16648311-C-T 14536431-C-T YY*
13718410-G-T 11562734-G-T *
13718395-G-A 11562719-G-A *
28807151-T-C 26661004-T-C *
13706168-G-A 11550492-G-A *
13450085-TCCACTCCAC-T 11294409-TCCACTCCAC-T *
13499445-A-C 11343769-A-C *
10034331-G-A 10196722-G-A Y*
13487539-C-G 11331863-C-G *
13489770-G-T 11334094-G-T *
10673235-C-T *
10673226-A-G *
3315577-C-T 3447536-C-T *
58858906-C-G 56731965-G-C *
13559692-T-C 11404016-T-C *
22241167-G-T 20079281-G-T DYZ19 *
13474473-A-T 11318797-A-T *
10777714-T-C *
13489424-C-T 11333748-C-T *
28810158-G-A 26664011-G-A *
13463209-C-T 11307533-C-T *
13472292-CCT-C 11316616-CCT-C *
13472289-G-GAA 11316613-G-GAA *
10093297-A-AAG 10255688-A-AAG *
13606219-G-A 11450543-G-A *
13465745-C-A 11310069-C-A *
56764219-A-T *
13484843-G-T 11329167-G-T *
13466440-G-T 11310764-G-T *
13463224-G-A 11307548-G-A *
13487880-G-A 11332204-G-A *
13487956-G-A 11332280-G-A *
13480129-G-A 11324453-G-A *
13480128-T-A 11324452-T-A *
13480126-G-C 11324450-G-C *
13480099-G-C 11324423-G-C *
13488346-G-C 11332670-G-C *
13489161-G-T 11333485-G-T *
13465553-G-T 11309877-G-T *
13476645-G-C 11320969-G-C *
13476246-C-T 11320570-C-T *
13476585-G-A 11320909-G-A *
10861896-A-G *
28810149-G-A 26664002-G-A *
13488716-A-ATGG 11333040-A-ATGG *
13486489-C-A 11330813-C-A *
56830296-T-TTA *
16648317-C-A 14536437-C-A YY*
10794438-C-A FT431484 *
5664525-G-A 5796484-G-A *
13489460-C-A 11333784-C-A *
22509354-G-A 20347468-G-A DYZ19 *
13726357-A-G 11570681-A-G *
13462347-C-A 11306671-C-A *
10797904-C-A *
13488781-T-G 11333105-T-G *
6403210-C-G 6535169-C-G *
13721327-G-C 11565651-G-C *
13721306-A-G 11565630-A-G *
28797044-T-A 26650897-T-A *
13488864-T-A 11333188-T-A *
22430300-T-A 20268414-T-A DYZ19 *
6403204-G-A 6535163-G-A *
56829854-G-GTT *
13267472-G-GT 11111796-G-GT *
13460864-G-C 11305188-G-C *
13460855-C-A 11305179-C-A *
13473870-A-T 11318194-A-T *
13473802-G-C 11318126-G-C *
28810144-C-G 26663997-C-G FT462556 *
13478208-C-G 11322532-C-G *
13489772-C-T 11334096-C-T *
13722698-G-A 11567022-G-A *
9992712-G-C 10155103-G-C Y*
9349188-T-C 9511579-T-C FGC80729 Y*
13461728-G-T 11306052-G-T *
56826133-G-A *
10826963-C-T *
10859640-C-A *
13485346-C-A 11329670-C-A *
13688502-G-C 11532826-G-C BY48166 *
56742783-A-C *
13473805-A-T 11318129-A-T *
13487853-G-A 11332177-G-A *
13462397-C-A 11306721-C-A *
13721092-G-T 11565416-G-T *
10093717-A-G 10256108-A-G *
6402808-T-A 6534767-T-A *
58875145-G-C 56715726-C-G *
10690890-C-T FT429213 *
9962677-C-A 10125068-C-A Y*
28818912-G-T 26672765-G-T *
13484902-A-G 11329226-A-G *
13488711-AC-A 11333035-AC-A *
13489630-C-CAA 11333954-C-CAA *
13257150-G-A 11101474-G-A *
28792829-A-C 26646682-A-C *
13264116-C-G 11108440-C-G *
10823278-G-C *
10775673-A-C *
10039721-C-G 10202112-C-G *
10039718-G-T 10202109-G-T *
9932098-C-G 10094489-C-G Y*
9916005-A-C 10078396-A-C Y*
28817499-T-C 26671352-T-C *
28812484-A-G 26666337-A-G *
28792820-T-G 26646673-T-G *
13267148-G-T 11111472-G-T *
28788970-T-A 26642823-T-A *
22511273-C-G 20349387-C-G DYZ19 *
16000957-T-C 13889077-T-C Y*
16000948-C-T 13889068-C-T Y*
16000935-T-C 13889055-T-C Y*
16000930-C-G 13889050-C-G Y*
13712725-A-C 11557049-A-C *
13711547-T-G 11555871-T-G *
13711525-A-T 11555849-A-T *
13711517-T-C 11555841-T-C *
13267068-G-T 11111392-G-T *
13423088-A-G 11267412-A-G FGC59614 *
13591316-A-C 11435640-A-C *
13554946-T-A 11399270-T-A *
13257142-A-C 11101466-A-C *
13257138-G-A 11101462-G-A *
10775668-C-G *
13520594-T-C 11364918-T-C *
13520576-G-A 11364900-G-A *
56875554-T-A *
56734515-A-G *
28812907-G-C 26666760-G-C *
28807845-C-T 26661698-C-T *
13542079-G-A 11386403-G-A *
13423127-A-G 11267451-A-G *
13542062-T-C 11386386-T-C *
13522317-G-A 11366641-G-A *
13499203-C-T 11343527-C-T *
13495006-A-G 11339330-A-G *
13495003-A-C 11339327-A-C *
13495000-G-C 11339324-G-C *
13467653-A-G 11311977-A-G *
13465562-A-G 11309886-A-G *
13439700-G-T 11284024-G-T *
13423144-A-G 11267468-A-G *
13611671-C-T 11455995-C-T *
13562168-T-G 11406492-T-G *
56862006-G-T *
13482138-C-G 11326462-C-G *
10039790-C-T 10202181-C-T *
10022375-G-A 10184766-G-A Y*
9945464-T-G 10107855-T-G Y*
9945445-T-C 10107836-T-C Y*
9924455-T-A 10086846-T-A Y*
13487471-T-C 11331795-T-C *
13487921-T-G 11332245-T-G *
13470121-C-T 11314445-C-T *
13489717-C-A 11334041-C-A *
10660446-T-A *
10826973-G-C *
13472368-T-C,G 11316692-T-C,G *
13478095-C-A 11322419-C-A *
10038617-G-A 10201008-G-A *
12372603-T-A FTB17414 *
13470590-C-G 11314914-C-G *
13470582-C-A 11314906-C-A *
13481004-C-T 11325328-C-T *
13470500-A-G 11314824-A-G *
13470499-C-T 11314823-C-T *
22511034-A-T 20349148-A-T DYZ19 *
10826970-T-A FT191216 *
11007848-C-A *
13562159-A-T 11406483-A-T *
13495339-A-G 11339663-A-G *
13562155-A-G 11406479-A-G *
13562145-A-C 11406469-A-C *
13558548-A-G 11402872-A-G *
13552325-A-G 11396649-A-G *
13546835-A-G 11391159-A-G *
13546834-C-A 11391158-C-A *
13534935-A-G 11379259-A-G *
13534929-G-T 11379253-G-T *
13499212-C-A 11343536-C-A *
13495343-T-C 11339667-T-C *
13486471-T-A 11330795-T-A *
11007851-G-C *
13482255-C-A,G 11326579-C-A,G *
13480082-C-A 11324406-C-A *
13468416-T-C 11312740-T-C *
13467600-C-A 11311924-C-A *
13465742-A-G 11310066-A-G *
13465185-C-G 11309509-C-G *
13442753-T-C 11287077-T-C *
13439676-G-C 11284000-G-C *
13347800-A-G 11192124-A-G *
13347718-C-A 11192042-C-A *
14473-G-T *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: YF8957416628836103304338318493
Used in age calculations16628836103304338318493
Counts of SNPs12728
Variant counts last updated 2022-11-28 04:08:48.



Big Tree Main Page