Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > Z193 > Z40483 > BY3654

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane38
IN87579
BigY3
IN87579
9619482-T-A 9781873-T-A IR3_Prx +A+
26131987-C-T 23985840-C-T P1_Y1 A*
26081235-A-G 23935088-A-G P1_Y1 A*
20730092-C-T 18568206-C-T P4_Prx A*
19717318-G-C 17605438-G-C P5_Prx A*
6250889-A-T 6382848-A-T IR3_Dst A*
6196134-A-C 6328093-A-C IR3_Dst A*
6195068-G-A 6327027-G-A IR3_Dst A*
6165974-G-C 6297933-G-C IR3_Dst A*
18290276-C-A 16178396-C-A P6_Prx +A*
10672178-C-G *A*
10855506-C-T +**
9722432-G-A 9884823-G-A IR3_Prx +**
9754485-G-A 9916876-G-A FT391827 ++
10753455-A-G FT429716 ++
13549528-A-C 11393852-A-C +**
11010519-C-T FT393571 ++
13216215-G-A 11060539-G-A BY84521 ++
13487240-CGG-C 11331564-CGG-C +
13487243-C-CAG 11331567-C-CAG +
13626269-T-A 11470593-T-A ++
13673169-G-T 11517493-G-T ++
9654397-AGAAAGAAG-A 9816788-AGAAAGAAG-A IR3_Prx ++
4593126-T-G 4725085-T-G FT391208 ++
5921114-T-A 6053073-T-A FT391385 ++
3393428-T-A 3525387-T-A FT391008 ++
4976079-G-C 5108038-G-C FT159047 +**
2732951-A-G 2864910-A-G FT390927 YY++
2829683-T-G 2961642-T-G FT390940 YY++
2866756-A-C 2998715-A-C YY+
3140382-A-C 3272341-A-C FT390978 ++
3369109-A-G 3501068-A-G FT391004 ++
3432851-T-A 3564810-T-A +**
5874028-TTGCCCTACACA-T 6005987-TTGCCCTACACA-T ++
3478842-G-T 3610801-G-T FT391019 ++
4235941-C-T 4367900-C-T FT391148 ++
4452920-T-C 4584879-T-C FT391181 ++
13739713-G-C 11584037-G-C +
4683272-C-T 4815231-C-T +
5229459-A-G 5361418-A-G FT391290 ++
13696132-A-G 11540456-A-G +
14605352-G-A 12493554-G-A FT392017 YY++
11674577-T-A FT451349 ++
19251491-G-A 17139611-G-A FT392653 YY++
28647069-T-A 26500922-T-A FT393101 ++
26344044-C-T 24197897-C-T P1_Y1 +
23836391-G-A 21674505-G-A BY12929 Y++
23484404-G-T 21322518-G-T YY+**
23476015-T-TG 21314129-T-TG ++
22032322-A-C 19870436-A-C FT392849 YY++
21969367-T-C 19807481-T-C FT392839 YY++
21834882-G-C 19672996-G-C FT392823 Y++
21798478-G-T 19636592-G-T YY++
21795443-T-A 19633557-T-A Y+**
21674001-C-G 19512115-C-G FT392795 YY++
21458144-G-GT 19296258-G-GT ++
21429765-T-C 19267879-T-C FT392762 YY++
21384458-G-A 19222572-G-A FT392754 YY++
19226898-A-G 17115018-A-G FT392646 YY++
14072689-C-A 11951983-C-A FT391918 YY++
19168048-G-C 17056168-G-C FT392635 Y++
19091965-C-T 16980085-C-T YY++
19020937-T-C 16909057-T-C FT392609 YY++
19005409-A-G 16893529-A-G FT392608 YY++
17780178-A-G 15668298-A-G FT392454 YY++
16189008-T-C 14077128-T-C FT392224 YY++
15804086-C-T 13692206-C-T Y+
15448058-T-A 13336178-T-A FT392127 YY++
15118752-G-A 13006839-G-A Y+
15092811-TA-T 12980899-TA-T +**
14990114-A-G 12878199-A-G YY+**
21068264-C-CA 18906378-C-CA ++
14458196-C-T 12337469-C-T YY++
14432574-C-G 12311847-C-G FT391990 Y++
3793658-GA-G 3925617-GA-G 10×A+**
5156060-A-G 5288019-A-G FT391280 ++
21390114-G-A 19228228-G-A BY156909 YY++
15203861-AAACAAC-A 13091947-AAACAAC-A 12×AAC+
58863074-T-A 56727797-A-T +
22237315-C-A 20075429-C-A DYZ19 +
13679679-G-A 11524003-G-A Z2354 PF4685 ++
7165183-AT-A 7297142-AT-A 8×T*
13483183-AGAGTTATAT-A 11327507-AGAGTTATAT-A *
13483193-CACCTGGGTGATCAGTGCGGAGATACTTCACAATACCCCCTGTAGTTGGAGCCTACACAAG-C 11327517-CACCTGGGTGATCAGTGCGGAGATACTTCACAATACCCCCTGTAGTTGGAGCCTACACAAG-C *
13484142-C-A 11328466-C-A *
22447656-C-T 20285770-C-T DYZ19 *
26344249-CAAA-C 24198102-CAAA-C P1_Y1 14×A*
11333033-T- *
11333032-G- *
13482094-G-T 11326418-G-T *
13488966-G-A 11333290-G-A *
13488976-G-C 11333300-G-C *
11333949-A- *
13489627-CACCA-C 11333951-CACCA-C *
13482317-T-C 11326641-T-C *
13482076-T-C 11326400-T-C *
13482093-A-C 11326417-A-C *
13481342-TGTTACATCACCTGGGTGATCCGTGCAGAGATATCTCACAATACACCCTGTAAGCAGAGCCTAGAAAAGA-AGTTACATCACCTGGGTGATCCGTGCAGAGATATCTCACAATACACCCTGTAAGCAGAGCCTAGAAAAGA,T 11325666-TGTTACATCACCTGGGTGATCCGTGCAGAGATATCTCACAATACACCCTGTAAGCAGAGCCTAGAAAAGA-AGTTACATCACCTGGGTGATCCGTGCAGAGATATCTCACAATACACCCTGTAAGCAGAGCCTAGAAAAGA,T *
13478847-C-A 11323171-C-A *
13478854-A-ACC 11323178-A-ACC *
13479159-C-CCAT 11323483-C-CCAT *
13480290-A-T 11324614-A-T *
13480410-T-G 11324734-T-G *
13480903-T-G 11325227-T-G *
13481355-G-T,T 11325679-G-T,T *
13482082-G-A 11326406-G-A *
13481363-C-A,A 11325687-C-A,A *
13481386-A-T,T 11325710-A-T,T *
13481395-G-T,T 11325719-G-T,T *
13481402-C-A,A 11325726-C-A,A *
13481407-A-C,C 11325731-A-C,C *
11333959-A- *
11333958-C- *
13504721-T-TG 11349045-T-TG *
13489762-C-CTAT 11334086-C-CTAT *
13726499-GGAATA-G 11570823-GGAATA-G *
13706150-A-T 11550474-A-T *
13711735-A-AACGGAACGGAATGGAATGGC 11556059-A-AACGGAACGGAATGGAATGGC *
13711816-A-ACG 11556140-A-ACG *
11562635-G- *
13718564-T-A 11562888-T-A *
13737378-C-G 11581702-C-G *
22279914-G-T 20118028-G-T DYZ19 *
13705310-T-C 11549634-T-C *
13965269-CAAAA-C,CAAA 11844563-CAAAA-C,CAAA 21×A*
14071354-CTTTTT-C,CTTTT 11950648-CTTTTT-C,CTTTT 25×T*
28582492-A-G 26436345-A-G FTB18381 *
14172757-A-ACAAATCATGCTAATTAAAATAATCATCACTTCACATATTTGTTATTTCTT 12052051-A-ACAAATCATGCTAATTAAAATAATCATCACTTCACATATTTGTTATTTCTT *
14203430-CAAAAAA-C,CAAA 12082724-CAAAAAA-C,CAAA 23×A****
14373779-C-T 12253075-C-T YY*
13706030-CATAGA-C 11550354-CATAGA-C *
13702104-G-T 11546428-G-T *
13497440-G-A 11341764-G-A *
13608647-C-CAAAA 11452971-C-CAAAA 27×A*
13478614-C-G 11322938-C-G *
13535447-C-CAATGCCA 11379771-C-CAATGCCA *
13547146-C-T 11391470-C-T *
13547149-T-A 11391473-T-A *
13547167-C-CT 11391491-C-CT *
13588908-G-C 11433232-G-C *
13740294-C-A 11584618-C-A *
13701934-G-C 11546258-G-C *
22422187-C-T 20260301-C-T DYZ19 *
13690726-T-C 11535050-T-C *
13690756-C-G 11535080-C-G *
6858592-C-CTTTT 6990551-C-CTTTT 25×T*
11544839-C- *
13701922-C-T 11546246-C-T *
13478619-T-A 11322943-T-A *
13476664-A-T 11320988-A-T *
13478582-G-T 11322906-G-T *
10025246-C-A 10187637-C-A Y*
10987867-TCC- *
10987862-TCCA- *
10987856-T- *
10987853-C- *
10967504-T-TTTCCA,TTTCCATTCCA *
10889251-G- *
22364637-G-C 20202751-G-C DYZ19 *
10756988-CCG-C *
10756986-A-ATT *
22364651-G-T 20202765-G-T DYZ19 *
20984748-TTATCTATC-T,TTATC 18822862-TTATCTATC-T,TTATC P4_Dst 12×TATC****
10632765-CAACTG-C *
10621141-A-G *
10052016-G-A 10214407-G-A *
10020330-A-G 10182721-A-G Y*
13482028-A-C 11326352-A-C *
9412310-G-T 9574701-G-T Y*
9316517-C-T 9478908-C-T Y*
9318952-CT-C 9481343-CT-C *
9318957-G-A 9481348-G-A Y*
9412202-T-C 9574593-T-C Y*
9412267-C-G 9574658-C-G Y*
9412309-T-C 9574700-T-C Y*
9510732-CCTCTCTCT-C,C 9673123-CCTCTCTCT-C,C 14×CT*
9965775-G-A 10128166-G-A Y*
9577038-A-T 9739429-A-T IR3_Prx *
22052900-CA-C 19891014-CA-C 10×A*
22484531-G-T 20322645-G-T DYZ19 *
4916063-A-AT 5048022-A-AT 10×T*
6447791-G-T 6579750-G-T *
9945424-AT-A 10107815-AT-A *
10988586-ATTCCATT-A *
13473784-T-A 11318108-T-A *
13476686-T-C 11321010-T-C *
13470492-C-A 11314816-C-A *
13465024-G-A 11309348-G-A *
13465027-A-T 11309351-A-T *
13465035-C-A 11309359-C-A *
13465072-G-C 11309396-G-C *
13469202-T-A 11313526-T-A *
13470473-G-A 11314797-G-A *
13470510-G-A 11314834-G-A *
13464991-G-T 11309315-G-T *
13470516-A-G 11314840-A-G *
11316691-G- *
11316692-T- *
13476537-C-T 11320861-C-T *
13476658-A-T 11320982-A-T *
14385440-A-G 12264736-A-G Y*
13465020-A-T 11309344-A-T *
13464983-A-C 11309307-A-C *
13270009-A-T 11114333-A-T *
11291461-CATTCCATTCCATTCCATTCT- *
13279998-CAAAA-C,CAA 11124322-CAAAA-C,CAA 26×A*
13283105-CT-C 11127429-CT-C *
13287720-G-A 11132044-G-A *
13296184-G-GTTTT 11140508-G-GTTTT 14×T*
13303106-A-G 11147430-A-G *
13392768-C-CA 11237092-C-CA 11×A*
11292649-CA- *
13464979-G-A 11309303-G-A *
11295257-TTCTAC- *
13451897-T-TTCCATTCCATTC 11296221-T-TTCCATTCCATTC *
13461102-C-G 11305426-C-G *
13463647-G-T 11307971-G-T *
13463667-A-G 11307991-A-G *
13464975-C-G 11309299-C-G *
14381548-G-A 12260844-G-A Y*
14450598-T-C 12329871-T-C YY*
22278729-T-G 20116843-T-G PF1118 DYZ19 *
22722338-CT-C,CTTT 20560452-CT-C,CTTT 24×T*
28620782-C-G 26474635-C-G Y*
28620579-G-T 26474432-G-T Y*
28508007-CA-C,CAAA 26361860-CA-C,CAAA 14×A*
28480209-C-T 26334062-C-T 12×A*
28372162-A-AT 26226015-A-AT P1_gr2 9×T*
26834745-GAAGA-G,GAAGAAAGA 24688598-GAAGA-G,GAAGAAAGA P1_g2 12×AAGA*
22484529-A-C 20322643-A-C BY224643 DYZ19 *
25937661-AT-A 23791514-AT-A P1_Y1 9×T*
24389735-GTTTT-G 22243588-GTTTT-G 14×T*
24043877-A-C 21897730-A-C Y*
22278704-A-G 20116818-A-G DYZ19 *
24673369-T-TA 22527222-T-TA P3_b2 10×A*
3107155-A-T 3239114-A-T *
22914674-CAA-C,CA 20752788-CAA-C,CA 27×A*
22564743-C-T 20402857-C-T YY*
28740774-A-G 26594627-A-G *
22438600-C-T 20276714-C-T DYZ19 *
3895183-T-C 4027142-T-C *
22286573-C-A 20124687-C-A DYZ19 *
22299726-AG-A 20137840-AG-A DYZ19 *
22299728-TTGTTATGTCCAGAGTTTGTTCTTTCAGATGTGTCCAGAGTTTCTTTCTACTGGCAGGTTCATGGTCTTGCTCACTTCAATAATGAAGCTCCAGTCCGTTACGGTGAGTGTTACAGTACTTAAAG-T 20137842-TTGTTATGTCCAGAGTTTGTTCTTTCAGATGTGTCCAGAGTTTCTTTCTACTGGCAGGTTCATGGTCTTGCTCACTTCAATAATGAAGCTCCAGTCCGTTACGGTGAGTGTTACAGTACTTAAAG-T DYZ19 *
22422179-G-C 20260293-G-C BY48251 DYZ19 *
22424373-C-T 20262487-C-T DYZ19 *
22441112-A-T 20279226-A-T DYZ19 ***
22564740-C-T 20402854-C-T YY*
22443201-G-A 20281315-G-A DYZ19 *
22443202-G-A 20281316-G-A DYZ19 *
22475785-A-G 20313899-A-G DYZ19 ***
22484520-C-G 20322634-C-G DYZ19 *
22510983-C-T 20349097-C-T DYZ19 *
22528335-G-T 20366449-G-T Y*
13740016-T-C 11584340-T-C *
28791752-A-ATT 26645605-A-ATT *
21992963-T-TA,TAA 19831077-T-TA,TAA 23×A*
56866191-CAAG-C *
56827687-T-C,TGCCATCCGATTC *
56830554-GCAT- *
56830555-C- *
56834790-C-CATTCCACTCCACTCCATTCA,CATTCCATTCCACTCCACTCA *
56835388-C- *
56864091-A-T *
56876942-C-A *
56827152-A- *
56880509-A-T *
13298062-T-C 11142386-T-C *
4564938-T-TA 4696897-T-TA 10×A*
58865824-T-A 56725047-A-T *
13464964-C-T 11309288-C-T *
13740008-A-C 11584332-A-C *
56827157-C- *
56763413-C-T *
28791754-TGG-T 26645607-TGG-T *
56685786-GAA-G *
28797741-AG-A 26651594-AG-A *
28797743-G-C 26651596-G-C *
26659085-T- *
28812845-AG-A 26666698-AG-A *
28812847-G-C 26666700-G-C *
26673051-A- *
56685792-AATGGAAACAAATG-A *
56763409-A-T *
56706869-T-C *
56706874-GAATGGAAAGTAATCC-G *
56706959-C-CAATGG 4×AATGG*
56749628-A-G *
56749829-T-G *
56756844-C-G 8×AATGG*
22001992-A-T 19840106-A-T YY*
7321714-CCA-C 7453673-CCA-C *
9240978-C-G 9403369-C-G Y*
16064231-C-T 13952351-C-T Y*
15507783-G-GT,T 13395903-G-GT,T 25×T*
13297284-G-T 11141608-G-T *
15882393-C-A 13770513-C-A YY*
15920422-A-G 13808542-A-G Y*
15949889-G-A 13838009-G-A YY*
16022023-G-T 13910143-G-T Y*
16134195-G-A 14022315-G-A *
15320883-CAA-C,CA 13209001-CAA-C,CA 11×A*
9964967-G-A 10127358-G-A Y*
16545441-A-C 14433561-A-C YY*
16979426-T-C 14867546-T-C Y*
17118396-T-TTC 15006516-T-TTC *
17143891-ATTT-A,ATTTT 15032011-ATTT-A,ATTTT 35×T*
17159620-C-A 15047740-C-A YY*
13306720-C-T 11151044-C-T *
13152819-TGGGG-T,TGGG 13×G****
17321250-T-C 15209370-T-C YY*
14995444-G-A 12883529-G-A YY****
21512662-TTC-T 19350776-TTC-T *
13486592-A-T 11330916-A-T *
14794351-CT-C,CTTT 12682422-CT-C,CTTT 14×T*
14826129-TTA-T 12714196-TTA-T *
14949379-T-C 12837453-T-C YY*
13411803-C-T 11256127-C-T *
13389870-T-G 11234194-T-G *
15248074-G-A 13136160-G-A Y*
13307024-A-T 11151348-A-T *
15118761-G-A 13006848-G-A Y*
15151502-CAAAAAA-C,CAAAAA 13039589-CAAAAAA-C,CAAAAA 23×A*
15203861-AAACAAC-A,A 13091947-AAACAAC-A,A 12×AAC*
15208868-A-T 13096954-A-T YY*
15248058-G-A 13136144-G-A Y*
17284492-T-C 15172612-T-C FTB48827 YY*
17538501-G-A 15426621-G-A Y*
13256166-C-T 11100490-C-T *
21373561-A-G 19211675-A-G YY*
19223052-TA-T 17111172-TA-T *
19223220-G-T 17111340-G-T YY****
22484530-A-T 20322644-A-T DYZ19 *
16723271-C-T 14611391-C-T FT59 Y13×T*
19271381-A-G 17159501-A-G YY*
18658115-T- P4_Gap *
16175584-GCA-G 14063704-GCA-G *
19128651-A-G 17016771-A-G YY*
15247995-C-G 13136081-C-G Y*
13555729-G-A 11400053-G-A *
21475872-T-C 19313986-T-C Y*
13555727-T-A 11400051-T-A *
13326375-C-T 11170699-C-T *
13326150-TTTC-T 11170474-TTTC-T *
9191076-AACAC-A 9353467-AACAC-A 20×AC*
19125694-CA-C,CAA 17013814-CA-C,CAA 24×A*
9936735-T-A 10099126-T-A Y*
18516268-G-A 16404388-G-A P6_Dst *
18019832-CT-C,CTT 15907952-CT-C,CTT 22×T*
18060167-T-C 15948287-T-C YY*
8582982-CAG-C 8714941-CAG-C *
18340731-G-GTT 16228851-G-GTT P6_Prx 13×T*
18516264-G-A 16404384-G-A P6_Dst *
18516265-G-A 16404385-G-A P6_Dst *
18516271-G-A 16404391-G-A P6_Dst *
19102997-A-G 16991117-A-G YY****
18762178-TA-T 16650298-TA-T *
18762368-T-C 16650488-T-C YY*
28802543-G-T 26656396-G-T *
28802541-T-A 26656394-T-A *
19047974-C-T 16936094-C-T YY*
13740309-T-G 11584633-T-G *
8843536-ATTTT-A,ATT 8975495-ATTTT-A,ATT 23×T*
9303195-C-A 9465586-C-A Y*
9340316-GTGTT- *
13439247-A-G 11283571-A-G *
4982523-AT-A,ATT 5114482-AT-A,ATT 23×T*
56844821-C-G *
56844819-C-A *
22486969-T-A 20325083-T-A DYZ19 *
13606401-A-C 11450725-A-C *
13470502-C-T 11314826-C-T *
13375827-T-A 11220151-T-A *
13375825-T-C 11220149-T-C *
13590830-T-C 11435154-T-C *
13590824-A-G 11435148-A-G *
13552325-A-G 11396649-A-G *
13540248-C-T 11384572-C-T *
13486460-C-G 11330784-C-G *
13478421-G-T 11322745-G-T *
13252614-C-G 11096938-C-G *
7490622-T-G 7622581-T-G IR1_L *
13470054-G-A 11314378-G-A *
14570756-ATTT-A,ATT 12458956-ATTT-A,ATT 22×T*
10894208-C-G *
17090839-ATT-A,AT 14978959-ATT-A,AT 29×T*
13728730-G-T 11573054-G-T *
21687983-C-CAG 19526097-C-CAG *
13488716-A-ATGG 11333040-A-ATGG *
24385514-G-GT 22239367-G-GT 9×T*
14560190-AT-A 12448391-AT-A 10×T*
5204641-CAA-C,CA 5336600-CAA-C,CA 22×A*
3330251-G-GTT 3462210-G-GTT 12×T*
56763836-C-G *
56763834-C-T *
13465082-G-A 11309406-G-A *
13420041-T-C 11264365-T-C *
19059747-CT-C,CTT 16947867-CT-C,CTT 25×T****
13482308-C-A 11326632-C-A *
13590835-T-A 11435159-T-A *
13443606-T-C 11287930-T-C *
3260269-T-C 3392228-T-C *
19337633-CTTTT-C,CTTT 17225753-CTTTT-C,CTTT 22×T*
3705659-C-CA 3837618-C-CA 10×A*
9177921-CTTTGTG-C 9340312-CTTTGTG-C *
21547859-CTGTG-C,CTG 19385973-CTGTG-C,CTG 17×TG*
13606877-CAAAA-C,CAAA 11451201-CAAAA-C,CAAA 25×A*
22278491-C-G 20116605-C-G DYZ19 *
22278499-T-A 20116613-T-A DYZ19 *
56884762-C-T *
13563578-A-T 11407902-A-T *
13400504-C-CT 11244828-C-CT *
9976830-C-A 10139221-C-A Y*
22278510-G-A 20116624-G-A DYZ19 *
3672016-A-AT 3803975-A-AT 9×T*
17597154-CTTTT-C,CTT 15485274-CTTTT-C,CTT 20×T*
4316466-T-C 4448425-T-C *
9936698-A-G 10099089-A-G Y*
13408552-T-C 11252876-T-C *
13469401-C-G 11313725-C-G *
6091720-ATTT-A,AT 6223679-ATTT-A,AT 28×T*
23544848-T-C 21382962-T-C YY*
13490000-A-T 11334324-A-T *
58905172-A-T 56685699-T-A *
23505495-C-CA,CAA 21343609-C-CA,CAA 23×A*
21086136-TAA-T,TAAA 18924250-TAA-T,TAAA 24×A*
22437694-C-G 20275808-C-G DYZ19 *
3029494-C-T 3161453-C-T *
13362944-C-G 11207268-C-G *
13603629-A-AT 11447953-A-AT 15×T*
18204985-CA-C,CAA 16093105-CA-C,CAA 23×A*
15489897-GA-G 13378017-GA-G 9×A*
56724874-T-A *
28536891-T-G 26390744-T-G *
14934306-C-CTT 12822371-C-CTT 15×T*
21558722-CAA-C,CA 19396836-CAA-C,CA 16×A*
22580068-CT-C,CTT 20418182-CT-C,CTT 19×T*
16409013-CT-C,CTT 14297133-CT-C,CTT 18×T*
11029456-T-A *
17302239-TAA-T,TAAA 15190359-TAA-T,TAAA 22×A*
10894349-A-T *
15259278-C-CAAA 13147362-C-CAAA 15×A*
22303327-C-T 20141441-C-T DYZ19 *
10988657-T-C *
5626506-C-CT 5758465-C-CT 10×T*
28536007-TACAC-T 26389860-TACAC-T 12×AC*
19291569-A-AT 17179689-A-AT 10×T*
21687951-AACAC-A 19526065-AACAC-A 17×AC*
7085874-G-GA 7217833-G-GA 10×A*
5032747-C-CA 5164706-C-CA 10×A*
13478349-G-T 11322673-G-T *
21039312-CT-C 18877426-CT-C 10×T*
28588284-A-G 26442137-A-G *
13474759-G-A 11319083-G-A *
10937787-ATCCAT-A *
21148719-AT-A 18986833-AT-A 10×T*
14819674-C-CTT 12707741-C-CTT 15×T*
11029476-GTCAC-G *
11029474-C-G *
11029465-A-G *
11029460-A-G *
11029455-C-A *
11029418-T-TTGCATACAC *
8901991-CTTTTTTTT-C 9033950-CTTTTTTTT-C 19×T*
6457773-TAA-T 6589732-TAA-T 15×A*
6191304-C-CAA 6323263-C-CAA IR3_Dst 15×A*
13465083-C-A 11309407-C-A *
16908451-TAAAA-T,TAAA 14796571-TAAAA-T,TAAA 21×A*
2840099-CAAAAAAA-C,CAAAAA 2972058-CAAAAAAA-C,CAAAAA 20×A*
8281234-C-CA 8413193-C-CA 10×A*
15928702-CAAAA-C,CAAA 13816822-CAAAA-C,CAAA 19×A*
13480887-C-A 11325211-C-A *
13298038-T-C 11142362-T-C *
13482085-C-T 11326409-C-T *
15163300-A-ATT 13051386-A-ATT 15×T*
4200055-CAAA-C 4332014-CAAA-C 23×A*
23427133-CAAA-C 21265247-CAAA-C 12×A*
16940234-C-T 14828354-C-T YY*
10020162-C-A 10182553-C-A Y*
13468031-A-G 11312355-A-G *
25815191-A-ATG 23669044-A-ATG P1_b3 13×TG*
13377975-T-A 11222299-T-A *
4686573-CAAA-C 4818532-CAAA-C 15×A*
10860065-C-A **
7135407-TTG-T 7267366-TTG-T *
13480905-C-A 11325229-C-A *
8618781-GT-G 8750740-GT-G 10×T*
4390006-GA-G 4521965-GA-G 10×A*
27264837-T-TA 25118690-T-TA P1_g3 12×A*
7470700-CAA-C,CAAAA 7602659-CAA-C,CAAAA IR1_L 25×A*
28006373-T-TAC 25860226-T-TAC P1_Y2 16×AC*
28804238-C-A 26658091-C-A *
14373777-A-C 12253073-A-C YY*
17937252-C-CA 15825372-C-CA 9×A*
5666756-T-TA 5798715-T-TA 10×A*
5418148-GAA-G 5550107-GAA-G 14×A*
28523123-C-CT 26376976-C-CT 9×T*
28633329-TA-T 26487182-TA-T *
13465049-T-C 11309373-T-C BY85714 *
5035398-G-GA 5167357-G-GA 10×A*
14458558-CA-C,CAA 12337831-CA-C,CAA 21×A*
3570934-ATT-A 3702893-ATT-A 13×T*
22776653-T-TAA 20614767-T-TAA 12×A*
4464429-GT-G 4596388-GT-G 10×T*
3910053-C-T 4042012-C-T *
3939770-T-C 4071729-T-C *
4008588-C-CAA 4140547-C-CAA 10×A*
22278198-C-T 20116312-C-T DYZ19 *
4317681-C-A 4449640-C-A *
4440890-G-T 4572849-G-T *
4505437-GCA-G 4637396-GCA-G *
3846106-T-C 3978065-T-C *
13486465-G-T 11330789-G-T *
4594333-T-C 4726292-T-C *
4644842-G-A 4776801-G-A *
13745060-G-T 11589384-G-T *
4792510-A-AG 4924469-A-AG *
4965913-C-A 5097872-C-A *
3858633-G-GT 3990592-G-GT *
3842634-T-A 3974593-T-A *
5014948-G-T 5146907-G-T *
22316807-G-C 20154921-G-C BY25068 DYZ19 *
13473969-G-A 11318293-G-A *
6020688-G-GTTT 6152647-G-GTTT 23×T*
2859986-T-C 2991945-T-C YY*
21932179-C-CA 19770293-C-CA 9×A*
3010355-G-T 3142314-G-T *
3086559-A-T 3218518-A-T *
3300992-C-CAA 3432951-C-CAA 12×A*
3720167-T-TGGGGGGGGGGGGGGGG 3852126-T-TGGGGGGGGGGGGGGGG *
3367394-A-T 3499353-A-T *
22479339-G-C 20317453-G-C 6872917-G-ABY48292 DYZ19 *
23771877-GT-G 21609991-GT-G 10×T*
22508621-C-T 20346735-C-T BY165505 DYZ19 *
3480844-C-CTG 3612803-C-CTG *
3557049-AT-A 3689008-AT-A *
4983778-T-A 5115737-T-A *
10019453-A-AG 10181844-A-AG *
13489855-C-A 11334179-C-A *
8428944-CAAA-C,CA 8560903-CAAA-C,CA 25×A*
7085377-G-GAA 7217336-G-GAA 10×A*
7104855-A-G 7236814-A-G YY*
7208352-T-G 7340311-T-G YY*
7336683-T-TTAGA,TTAGATAGA 7468642-T-TTAGA,TTAGATAGA 13×TAGA*
7490650-T-G 7622609-T-G IR1_L *
7758515-C-A 7890474-C-A Y*
8525215-T-C 8657174-T-C YY*
6601232-T-C 6733191-T-C *
8563745-CTTT-C,CTTTT 8695704-CTTT-C,CTTTT 21×T*
8644324-CAAAAA-C 8776283-CAAAAA-C 32×A****
8892481-T- *
8812563-G-T 8944522-G-T Y***
8888375-CTT-C,CT 9020334-CTT-C,CT 25×T*
8908007-A-G 9039966-A-G *
7076612-CAA-AAA,C 7208571-CAA-AAA,C 29×A*
6595250-A-ACG 6727209-A-ACG *
5207651-T-G 5339610-T-G *
5512901-G-T 5644860-G-T *
5227087-CAAA-C,CAA 5359046-CAAA-C,CAA 21×A*
13595434-T-C 11439758-T-C *
5232769-G-T 5364728-G-T *
5278411-C-CAA 5410370-C-CAA 13×A*
5337399-C-CT 5469358-C-CT 8×T*
5486876-CA-C,CAAA 5618835-CA-C,CAAA 21×A*
5565319-T-G 5697278-T-G *
6525162-AT-A,A 6657121-AT-A,A 11×T*
5743562-T-A 5875521-T-A *
28008036-CAA-C 25861889-CAA-C P1_Y2 17×A*
9997063-A-C 10159454-A-C A11740 Y*
6103758-T-TAA 6235717-T-TAA 12×A*
6206248-T-C 6338207-T-C IR3_Dst *
6534414-CTTTCGTCGTTGTCGTGAAATACCGACGTATATCTTATGTTAGTCGGTGTCGTGAAATACCGACGTATATATTAT- *
6446346-A-G 6578305-A-G ***
13489860-G-A 11334184-G-A *
13288665-C-A 11132989-C-A *
13478491-G-C 11322815-G-C *
13462097-C-A 11306421-C-A *
13489639-C-CCCAT 11333963-C-CCCAT *
13478490-G-C 11322814-G-C *
13486036-G-C 11330360-G-C *
13375835-TTTTG-T 11220159-TTTTG-T *
56850031-C-CCT *
56850026-TCA-T *
56850025-A-G *
56832860-ATTCCATTCCACTCTATTCCACTCCACTCAACTCAATTCCACTCCCCTCCACTCCACTCCATTCCACTCCATTCCACTCCCCTCCCCTCCATTGCATTCCC-A *
10019469-GAA-G 10181860-GAA-G *
10019462-AG-A 10181853-AG-A *
10019458-A-AGATAG 10181849-A-AGATAG *
13469400-C-G 11313724-C-G *
13462139-C-T 11306463-C-T *
13462105-A-C 11306429-A-C *
13462081-C-A 11306405-C-A *
3514522-CTT-C,CT 3646481-CTT-C,CT 16×T****
13241544-T-A 11085868-T-A *
5260410-CAAAAA-C 5392369-CAAAAA-C 20×A*
13465039-T-A 11309363-T-A *
2993615-AT-A 3125574-AT-A 9×T*
13377552-T-C 11221876-T-C *
13690745-C-G 11535069-C-G *
6402403-A-C 6534362-A-C FT75543 *
13730693-T-G 11575017-T-G *
13252599-T-C 11096923-T-C *
13860000-G-GA 11739294-G-GA *
13860001-G-GGGGA 11739295-G-GGGGA *
22447435-C-G 20285549-C-G DYZ19 *
9984607-G-T 10146998-G-T Y*
13490020-C-A 11334344-C-A *
28813883-A-T 26667736-A-T BY152189 *
13726488-AAGAAT-A 11570812-AAGAAT-A *
13489621-C-CAG 11333945-C-CAG *
10662173-A-AC *
10632802-ATTCCATTCCACTCCAT-A *
11032985-CAATTCCATTACCTTCAATT-C *
10894188-TTCC-T *
10894185-CCA-C *
13475336-G-A 11319660-G-A *
13745128-TCG-T 11589452-TCG-T *
13745127-C-CAT 11589451-C-CAT *
13508327-ACT-A 11352651-ACT-A 8×CT*
10632799-TC-T *
10632777-ACTCCTGTCCTCTTCT-A *
13475338-GTT-G 11319662-GTT-G *
13463618-C-T 11307942-C-T *
13475325-T-G 11319649-T-G *
13469152-G-C 11313476-G-C *
13252615-C-G 11096939-C-G *
13475337-A-AAG 11319661-A-AAG *
13563544-G-T 11407868-G-T *
56876124-CAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 50×A*
13463623-G-A 11307947-G-A *
13463643-C-T 11307967-C-T BY85662 *
13469366-A-G 11313690-A-G *
17459485-CA-C,CAA 15347605-CA-C,CAA 25×A*
13688181-A-AGAATGGAATGGAATGGAATG,G 11532505-A-AGAATGGAATGGAATGGAATG,G 8×GAATG*
13317742-C-T 11162066-C-T *
13462063-A-C 11306387-A-C *
13462069-A-T 11306393-A-T *
13730561-A-G 11574885-A-G *
13462076-G-C 11306400-G-C *
13464032-C-T 11308356-C-T *
9825043-A-T 9987434-A-T **
20744322-T-A 18582436-T-A P4_Prx **
20574963-TG-T 18413077-TG-T P5_Dst **
20107252-CG-C 17995372-CG-C P5_Dst **
6752310-T-G 6884269-T-G **
6230938-G-T 6362897-G-T IR3_Dst **
13455808-C-G 11300132-C-G **
18890464-CA-C,CAA 16778584-CA-C,CAA 15×A***
10678591-TCCAATCCACTCCACC-T,TCCATTCTATTCCATT ***
15138012-CTTTT-C,CTTTTTT 13026099-CTTTT-C,CTTTTTT 15×T***
13962042-CTT-C,CT 11841336-CTT-C,CT 28×T***
17006261-CTTTT-C,CTTT 14894381-CTTTT-C,CTTT 17×T***
7199342-CTTT-C,CTTTT 7331301-CTTT-C,CTTTT 24×T***
6915796-ATT-A,ATTT 7047755-ATT-A,ATTT 22×T***
4375372-T-C 4507331-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: IN875791574868493874708272270
Kit: IN875791496662693849818309882
Used in age calculations1574868493874708309882
Counts of SNPs9355
Variant counts last updated 2023-01-30 03:01:39.



Big Tree Main Page