Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
N36716
15309968-T-TA 13198073-T-TA 10×AA*
22304757-C-A 20142871-C-A DYZ19 A*
56831556-G-T A*
13449956-C-A 11294280-C-A A*
13449527-C-T 11293851-C-T A*
10744260-T-G A*
56832307-T-C A*
58992073-C-A 56845926-C-A A*
20695758-G-A 18533872-G-A P4_Prx A*
24280426-A-AT 22134279-A-AT P3_t1 9×TA*
9596493-A-ATG 9758884-A-ATG IR3_Prx 12×TGA*
22231465-G-A 20069579-G-A DYZ19 A*
22274817-G-C 20112931-G-C DYZ19 A*
13488479-C-T 11332803-C-T A*
13687755-T-C 11532079-T-C A*
19814248-C-T 17702368-C-T P5_Prx A*
6402187-T-C 6534146-T-C A*
28817547-T-A 26671400-T-A A*
13448491-C-A 11292815-C-A A*
13450650-T-C 11294974-T-C A*
13450671-G-A 11294995-G-A A*
13448000-C-T 11292324-C-T A*
24288610-C-T 22142463-C-T P3_t1 A*
14947665-C-T 12835739-C-T FT57909 YY+
14254504-C-T 12133798-C-T FT57813 YY+
14127269-T-C 12006563-T-C FT57788 YY+
5497118-A-G 5629077-A-G FT57187 +
6093825-C-T 6225784-C-T FT57298 +
9509286-G-T 9671677-G-T FT57689 +
10906554-G-A +
10081025-G-C 10243416-G-C +
9806314-G-A 9968705-G-A FT57703 YY+
7045009-C-T 7176968-C-T FT57394 Y+
9444592-G-C 9606983-G-C FT57681 YY+
9437901-G-A 9600292-G-A BY178481 YY+
8644139-C-T 8776098-C-T FT57608 YY+
15663387-C-G 13551507-C-G FT57979 YY+
7084126-C-T 7216085-C-T FT57403 YY+
15617201-G-A 13505321-G-A BY178852 YY+
15789158-G-C 13677278-G-C FT58007 Y+
15668872-T-C 13556992-T-C FT57980 Y+
21960815-C-T 19798929-C-T FT58616 YY+
28497654-A-G 26351507-A-G FT58846 Y+
23995217-TCATAAA-T 21849070-TCATAAA-T +
23647188-C-T 21485302-C-T FT58793 Y+
23356183-C-T 21194297-C-T FT58766 Y+
23246139-T-C 21084253-T-C FT58747 YY+
23026101-T-C 20864215-T-C FT58711 YY+
22782385-C-T 20620499-C-T FT58674 Y+
22763703-G-A 20601817-G-A BY18474 YY+
22464412-G-T 20302526-G-T DYZ19 +
22440826-G-T 20278940-G-T BY25419 DYZ19 +
22156523-T-G 19994637-T-G FT58643 YY+
22122640-GA-G 19960754-GA-G +
22070898-C-T 19909012-C-T FT58635 YY+
21520931-A-G 19359045-A-G FT58549 YY+
15753733-C-T 13641853-C-T FT57998 YY+
21123525-T-C 18961639-T-C FT58493 Y+
20700386-T-C 18538500-T-C P4_Prx +
20392481-T-C 18230595-T-C P5_Dst +
18789644-T-C 16677764-T-C FT58360 YY+
17438391-G-T 15326511-G-T FT58209 YY+
17183735-G-A 15071855-G-A FT58165 YY+
16965124-G-C 14853244-G-C FT58139 YY+
16783994-T-C 14672114-T-C FT58118 YY+
16648621-T-A 14536741-T-A YY+
16384262-T-C 14272382-T-C FT58058 Y+
16263588-G-A 14151708-G-A FT58046 YY+
15952151-G-C 13840271-G-C FT58021 YY+
5141658-A-T 5273617-A-T FT57123 +
15774005-T-A 13662125-T-A FT58003 Y+
5207890-A-G 5339849-A-G FT57135 +
56823008-A-G +
4642720-T-C 4774679-T-C FT57037 +
7172242-C-T 7304201-C-T ALK120 YY+
13213889-G-A 11058213-G-A +
5866538-C-T 5998497-C-T FGC73299 +
8577771-G-A 8709730-G-A FGC47254 YY+
4150646-C-G 4282605-C-G FT56929 +
18048723-T-TTGA 15936843-T-TTGA 11×TGA*
6931580-A-G 7063539-A-G FGC21797 YY*
8342842-T-TA 8474801-T-TA 10×A*
10887326-ACCATT-A *
14492236-T-TCA 12380433-T-TCA 15×CA*
19283984-C-CTATGG 17172104-C-CTATGG 7×TATGG*
6931595-G-T 7063554-G-T YY*
22318950-G-A 20157064-G-A BY47931 DYZ19 *
13489619-ACCCCCACCACCACCCACCACCC-A,ACCCCCACACCCACCCCCAACTC 11333943-ACCCCCACCACCACCCACCACCC-A,ACCCCCACACCCACCCCCAACTC *
6931586-T-C 7063545-T-C FGC21798 YY*
23831252-CTTTT-C 21669366-CTTTT-C 26×T**
18886085-A-G 16774205-A-G **
19998720-A-T 17886840-A-T P5_Prx **
8724348-GTA-G 8856307-GTA-G **
9990487-C-T 10152878-C-T **
18890563-G-GGAAAGAAA 16778683-G-GGAAAGAAA 11×GAAA**
7269610-C-CT 7401569-C-CT 22×T**
13242241-C-CT 11086565-C-CT 21×T**
7443490-A-T 7575449-A-T CTS1500 Z2709 **
22487653-C-T 20325767-C-T DYZ19 **
6918535-CAA-C 7050494-CAA-C 31×A**
22780933-G-A 20619047-G-A **
6944943-CAAAAAA-C 7076902-CAAAAAA-C 28×A**
10776104-CCACTCCATTT-C **
3132763-AATT-A 3264722-AATT-A **
7414277-CAA-C 7546236-CAA-C 27×A**
19125478-G-A 17013598-G-A **
25889972-A-G 23743825-A-G P1_Y1 **
20104255-GGGAGAGA-G 17992375-GGGAGAGA-G P5_Dst **
6330133-A-G 6462092-A-G IR3_Dst **
8724350-A-G 8856309-A-G Y137166 **
14160986-T-C 12040280-T-C **
14493586-T-C 12381783-T-C **
15023102-G-A 12911190-G-A **
22304318-A-T 20142432-A-T BY45389 DYZ19 ***
8101956-AT-A 8233915-AT-A 11×T***
22804033-A-G 20642147-A-G ***
17278273-CGAAAGAAAGAAAGAAA-C 15166393-CGAAAGAAAGAAAGAAA-C 16×GAAA***
5219375-T-G 5351334-T-G ***
16564350-TGATAGATA-T 14452470-TGATAGATA-T 11×GATA***
26068281-AC-A 23922134-AC-A P1_Y1 ***
59025465-A-AGG 56879318-A-AGG ***
13612982-CAT-C 11457306-CAT-C ***
2968166-GA-G 3100125-GA-G 13×A***
17379878-A-G 15267998-A-G ***
14339006-TTTTC-T 12218301-TTTTC-T 5×TTTC***
8660550-CAAA-C 8792509-CAAA-C 18×A***
13470659-T-C 11314983-T-C ***
4790634-GA-G 4922593-GA-G 14×A***
7554786-AACAC-A,AAC 7686745-AACAC-A,AAC 22×AC***
3483105-T-TA 3615064-T-TA 9×A***
17951299-A-AT 15839419-A-AT 25×T***
7188780-T-TG 7320739-T-TG ***
8216406-CTTT-C,CTTTT 8348365-CTTT-C,CTTTT 16×T***
10672764-TCCGTTCCATA-T,TCTGTTCCATA ***
6417420-CTT-C 6549379-CTT-C 12×T***
10763208-C-T ***
15109457-A-ATT 12997544-A-ATT 14×T***
21671149-T-C 19509263-T-C ***
4338463-CT-C 4470422-CT-C 12×T***
19125466-C-T 17013586-C-T ***
6074688-A-ATG 6206647-A-ATG 22×TG***
17046715-GTT-G 14934835-GTT-G 25×T***
19436770-GAA-G 17324890-GAA-G ***
21363090-CAA-C 19201204-CAA-C 16×A***
13488588-C-T 11332912-C-T ***
18095756-T-C 15983876-T-C ***
19382304-G-GATT 17270424-G-GATT 7×ATT***
19138189-AAT-A 17026309-AAT-A ***
4976090-A-G 5108049-A-G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: N367161499037693886368306661
Used in age calculations1499037693886368306661
Counts of SNPs4032
Variant counts last updated 2019-10-28 04:27:26.



Big Tree Main Page